ID: 982097891

View in Genome Browser
Species Human (GRCh38)
Location 4:151939849-151939871
Sequence CAGAGTCAGCAGCAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 725
Summary {0: 1, 1: 0, 2: 9, 3: 69, 4: 646}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982097891_982097896 19 Left 982097891 4:151939849-151939871 CCACTCTGCTGCTGCTGACTCTG 0: 1
1: 0
2: 9
3: 69
4: 646
Right 982097896 4:151939891-151939913 CTTCCTTCTACGCTTGCCTGAGG 0: 1
1: 0
2: 2
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982097891 Original CRISPR CAGAGTCAGCAGCAGCAGAG TGG (reversed) Intergenic
900109899 1:1000966-1000988 CGAACTCAGCAGCAGCAAAGTGG + Intergenic
901332547 1:8422668-8422690 GAGAGGCAGCAGGAGCAAAGAGG + Intronic
901401038 1:9015184-9015206 CAGGGTCAGCAGCTGCAGCAGGG + Exonic
901466545 1:9425370-9425392 TAGAGTCAGCTGCAGTGGAGGGG + Intergenic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903372275 1:22844381-22844403 CAGAGACAGCAGCAGCACTCTGG - Intronic
903623375 1:24714277-24714299 CAGACCCAACAGGAGCAGAGTGG + Intergenic
903759026 1:25684882-25684904 CTGGGCCAGCAGCAGCACAGGGG + Intronic
903813475 1:26047312-26047334 CAGAGTCCAGAGAAGCAGAGAGG - Intergenic
904021514 1:27470102-27470124 CAGTGTCAGCAGAAGCACAAAGG + Intronic
904324619 1:29720275-29720297 CAGAGGCAGCAGGTGCAGGGAGG - Intergenic
904701891 1:32362653-32362675 CAGAGGCAGCATGAGCTGAGAGG + Exonic
904888569 1:33760787-33760809 GACAGCCATCAGCAGCAGAGTGG - Intronic
905017207 1:34785953-34785975 CAGACACAACAGCAGCACAGAGG + Exonic
905026715 1:34855516-34855538 CAGACCCAGCAGCAGCCGAGGGG - Exonic
905267580 1:36765276-36765298 CACAGTGAGGAGAAGCAGAGGGG - Intergenic
905338993 1:37265542-37265564 CAGAGACGGCAGTAGCAGAAGGG - Intergenic
905368521 1:37469641-37469663 CAGAGAGAGCAGGAACAGAGAGG - Intergenic
905803069 1:40858040-40858062 CAGGATCAGCAGCTGCAGAAGGG - Intergenic
906052618 1:42887553-42887575 CAGAGGCAGGACCAGCAGCGCGG + Intergenic
906278169 1:44533821-44533843 CAGAATGAGCAAAAGCAGAGAGG + Intronic
906547830 1:46634280-46634302 CTTAGGCAGGAGCAGCAGAGTGG + Exonic
907550178 1:55298536-55298558 CAGAGTAAGCAGGGGCAGATGGG + Intergenic
907834352 1:58094880-58094902 CAGTGTCAGCATCAGCTGAGTGG - Intronic
909493209 1:76248105-76248127 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
911753899 1:101530602-101530624 CAGAGTCAGAAAGAGCTGAGAGG + Intergenic
912723494 1:112039663-112039685 CACACTCAGCAGCTACAGAGAGG - Intergenic
913093611 1:115496452-115496474 CAGAGCCAGGAGCATCAGACTGG - Intergenic
913285756 1:117224973-117224995 TGCAGTCAGGAGCAGCAGAGTGG - Intergenic
913334712 1:117698594-117698616 CCGAAGCAGCAGCAGGAGAGAGG + Intergenic
914455724 1:147834544-147834566 CACCGTCAGCAGAAGCAGTGTGG - Intergenic
914676516 1:149910716-149910738 AAGTGACAGCATCAGCAGAGAGG + Intronic
914915635 1:151817540-151817562 CAGAGAAAGCAGCTGCAGAGGGG + Intronic
914920290 1:151842224-151842246 CAAATTCAGCAGCAGCGGTGAGG - Intergenic
915393155 1:155562436-155562458 CGGCGGCGGCAGCAGCAGAGTGG + Exonic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916217704 1:162411649-162411671 CAGACTCTGCAGCAGCAGGAGGG - Intronic
916584251 1:166136479-166136501 CAGAGACAGCAGCAGCTGTGAGG - Intronic
916607284 1:166355466-166355488 CAGAGTGAGCAGCGGCAGATGGG + Intergenic
917343856 1:174008428-174008450 CAGAGGAAGAAGCAGAAGAGGGG + Intronic
917345210 1:174022257-174022279 CAGCCTCAGCAGCAGCAGGTGGG - Exonic
917526547 1:175793299-175793321 CAGTGTCAACAGCCACAGAGAGG + Intergenic
918154580 1:181832555-181832577 CCGGGCCAGCAGCTGCAGAGGGG + Intergenic
918159948 1:181889229-181889251 GAGGGTGAGCAACAGCAGAGTGG + Intergenic
918290397 1:183102014-183102036 CAGATCCAGCAGCAGGACAGCGG + Intronic
918942977 1:191026215-191026237 CCGGGCCAGCAGCTGCAGAGGGG - Intergenic
919799569 1:201345347-201345369 AAGAGTCAGCTGCAGGAGGGAGG - Intergenic
919821677 1:201476893-201476915 CAGACTCAGCCCCATCAGAGGGG - Intergenic
920109696 1:203578744-203578766 CAGGGTCAGAAGCAGCGGAGAGG + Intergenic
920823331 1:209401649-209401671 CAGTGTCAGCCGCTGCAGAGAGG + Intergenic
921275300 1:213513151-213513173 CAAAGTCAGCAACAGCATGGAGG - Intergenic
922213238 1:223501118-223501140 GAGAGTCAGCATGAGCAGAAGGG - Intergenic
922464374 1:225836737-225836759 CAAACTCAGCAGAAGCAGAGAGG + Intronic
922790259 1:228307288-228307310 CAGAGTCTGGAGCAGGAGACAGG + Exonic
922821689 1:228489027-228489049 CAGAGTCAGCAGCTGCAGTGTGG + Exonic
923039409 1:230309035-230309057 CAGAGTCACCAGAAGCGGTGCGG + Intergenic
923338848 1:232991274-232991296 CAGAGGAGGCAGCAGCTGAGGGG + Intronic
924878144 1:248128451-248128473 GAGAGTTAGCAGAAGCAGGGTGG + Intergenic
924894120 1:248317260-248317282 GAGAGTGAGCAGAAGCAGAGTGG - Intergenic
1063149314 10:3322208-3322230 CAGAGGCAGGAGCAGCACTGGGG + Intergenic
1063174361 10:3538261-3538283 CACAGACAGCAGCAACAGACAGG - Intergenic
1063959718 10:11297295-11297317 CAGAGCCGGGAGCTGCAGAGTGG + Intronic
1063964930 10:11339464-11339486 CAAAGTCAGGAGCCACAGAGTGG + Intergenic
1064943565 10:20761998-20762020 CAGAGGGAACAGCATCAGAGAGG - Intergenic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1065897569 10:30177747-30177769 CTCATTCAGCAGCAGCAGTGGGG + Intergenic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1066756529 10:38717654-38717676 CAGAGGCAGCAGGTGGAGAGTGG + Intergenic
1067218847 10:44326853-44326875 CAGAGTCAGGTGCTGCAGAGGGG - Intergenic
1067251933 10:44593984-44594006 GACAGTGAGCAGAAGCAGAGTGG + Intergenic
1067819963 10:49519888-49519910 CTGAGGCAGCAGGTGCAGAGTGG - Intronic
1068575076 10:58675980-58676002 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1069091470 10:64204518-64204540 TAGGGTCAGCAGCAGCAGCAGGG - Intergenic
1069632892 10:69908153-69908175 GAAAGGCAGCAGCAGGAGAGGGG + Intronic
1069721199 10:70550378-70550400 CAGAATCAGAAGCTCCAGAGTGG - Intronic
1069781102 10:70956244-70956266 AGGAGCCAGCAGCAGCAGAAGGG - Intergenic
1069819745 10:71220137-71220159 CAGAGTCAGAAGCAGCTGAGAGG - Intronic
1069849043 10:71393262-71393284 CACAGGCAGCAGAAGCAGAAGGG - Intergenic
1069965316 10:72110403-72110425 CAGATTCAGGAGCAGCATGGAGG + Intronic
1070989395 10:80718311-80718333 GAGAGGCAGCCCCAGCAGAGAGG - Intergenic
1071339911 10:84636112-84636134 CAGAGTCATCAGCAGCAAGAAGG + Intergenic
1071467370 10:85953657-85953679 CATAGGCTGAAGCAGCAGAGAGG - Intronic
1071721123 10:88147186-88147208 ATGAGGCAGCAGCAGCACAGAGG + Intergenic
1072394356 10:95023472-95023494 GAGAGTGAGCTGAAGCAGAGTGG - Intergenic
1072733748 10:97865655-97865677 CAGTGGCAGCAGCAGCGGTGGGG + Exonic
1072953664 10:99870273-99870295 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1073262487 10:102201089-102201111 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1073432807 10:103497636-103497658 GGGAATCACCAGCAGCAGAGTGG - Intronic
1073854095 10:107655266-107655288 TAGAGACATCTGCAGCAGAGGGG + Intergenic
1074153336 10:110778073-110778095 CAAATTCAACAGCAGCAGAATGG - Intronic
1075228786 10:120653668-120653690 CAGACTCACCAGCAGCAAGGAGG + Intergenic
1075625628 10:123962744-123962766 CAGAGGCAGCACCTGGAGAGAGG - Intergenic
1075651301 10:124129568-124129590 CAGAGGCAGCAGCTGCAGAGTGG - Intergenic
1075725979 10:124611106-124611128 CTCATTCAGGAGCAGCAGAGTGG + Intronic
1076140872 10:128077734-128077756 CAGAAGCAGCAGCAGCAGACAGG + Exonic
1076244345 10:128934337-128934359 CAGCGTCAGCAGGAGCCAAGGGG - Intergenic
1076251902 10:128991380-128991402 CAGACTGTGCAGCTGCAGAGAGG - Intergenic
1077134486 11:991716-991738 CACAGTCACCAGCACCTGAGAGG + Intronic
1077799615 11:5524908-5524930 CAGGGGCAGCAGCTGTAGAGTGG + Intronic
1078065087 11:8073247-8073269 TAGAATCAGCAGCAGCAAAAGGG + Intronic
1078407367 11:11082080-11082102 CAGAGTCAGGAGCCACAGGGAGG + Intergenic
1078954640 11:16177823-16177845 CAGAGTGAGGTGCAGCAGAGTGG - Intronic
1079005343 11:16787895-16787917 CTGAGCTAGCAGCTGCAGAGAGG + Exonic
1079248993 11:18773494-18773516 CAGAGTCTGCAGACCCAGAGGGG + Intronic
1079803173 11:24896431-24896453 CTGGGCCAGCAGCTGCAGAGGGG + Intronic
1080773643 11:35365589-35365611 CAGAGACAGAGACAGCAGAGCGG - Intronic
1081163931 11:39785805-39785827 CAGGATCACCAGCTGCAGAGAGG - Intergenic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081380380 11:42407510-42407532 CAGCGCCACCAGCAGGAGAGTGG + Intergenic
1082072750 11:47952035-47952057 CAGAGTAGGCAGGGGCAGAGCGG + Intergenic
1083079822 11:60079648-60079670 CAGGGTGAGGAGGAGCAGAGGGG - Intergenic
1083618466 11:64037440-64037462 CGGAGTCAGCACCAGCTGACAGG - Intronic
1083630318 11:64091847-64091869 CAAAGGCAGGAGCACCAGAGCGG + Intronic
1083635743 11:64120079-64120101 CAAAGGCAGAAGCAGCAGCGGGG + Intronic
1083997964 11:66281521-66281543 AAGAGTACACAGCAGCAGAGTGG - Intronic
1084007475 11:66331051-66331073 CCAAGGCTGCAGCAGCAGAGGGG - Intronic
1084141510 11:67233780-67233802 CAGAGTCAGCAAGAAGAGAGGGG + Intronic
1084433699 11:69125923-69125945 CAGAGTGATCAGCAGCTGTGTGG + Intergenic
1085282613 11:75340918-75340940 CAGGGCCAGCAGCAGCAGTGTGG - Intronic
1085409538 11:76283033-76283055 CAGAGTCAGCAGCAGGGGCCAGG - Intergenic
1085704323 11:78772413-78772435 AAGACTGAGCAGCAGCAGAGAGG - Intronic
1087625769 11:100594529-100594551 CACACACAGCAGCAGCAGAGTGG - Intergenic
1088598140 11:111455071-111455093 CAGAGGGAGCAGCAGCAGGTGGG + Exonic
1088857984 11:113773448-113773470 CAGAGTGGGGACCAGCAGAGTGG - Intronic
1089060043 11:115618920-115618942 CAGAGGCAGCAGCAGCACCCAGG - Intergenic
1089912580 11:122116938-122116960 CTTACTTAGCAGCAGCAGAGAGG + Intergenic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090586186 11:128215493-128215515 CCGGGCCAGCAGCTGCAGAGGGG - Intergenic
1090987332 11:131780256-131780278 CAGGGACAGCAGGTGCAGAGAGG + Intronic
1091097694 11:132839621-132839643 CAGCGTCAACAACAGCAGTGTGG - Intronic
1091104852 11:132909044-132909066 CAGAGACAGAAGCATCAGTGCGG + Intronic
1091296806 11:134479677-134479699 CAGATTCAACAGCAGAAGAGTGG + Intergenic
1092047549 12:5442804-5442826 AAGACTCAGTGGCAGCAGAGTGG - Intronic
1092119382 12:6033538-6033560 CAGCCTCAGCAGCAAAAGAGAGG - Intronic
1092151168 12:6249877-6249899 CAGAGTCACCAGCAACAGCTGGG - Intergenic
1092211098 12:6646996-6647018 CAGAGGCAGGAGCAGCACTGCGG + Exonic
1093229646 12:16528033-16528055 CAGACTCAGTAGCAGAATAGAGG - Intronic
1093262041 12:16950498-16950520 CAGAGCCAGCTGGAGCCGAGAGG - Intergenic
1093608165 12:21119737-21119759 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1094393452 12:29978478-29978500 CAGAGTTAGCAGCAGACGATGGG + Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1095262707 12:40115633-40115655 CAGTGGTAGCAGCAGCAGAAGGG + Intergenic
1095595218 12:43950995-43951017 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1096317557 12:50581724-50581746 CTGAGTCAGCAGGAGTTGAGTGG - Intronic
1096459241 12:51813135-51813157 CAGAGGCAGCACCACTAGAGAGG - Intergenic
1096515536 12:52153227-52153249 CAGGGTCAGCAGAGGCTGAGGGG - Intergenic
1096868633 12:54579543-54579565 CAAAAACAGCAGCAGGAGAGAGG + Exonic
1097506444 12:60478705-60478727 TAGAATCAGCAGCCTCAGAGAGG - Intergenic
1097654516 12:62343692-62343714 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1098467080 12:70799856-70799878 CAGAGAGAGCAGCAGCAGGTAGG + Intronic
1099277919 12:80601718-80601740 TAGAGTCAGAGGCAGAAGAGAGG + Intronic
1101097494 12:101357851-101357873 CAGTATCAGCAGCATCTGAGGGG + Intronic
1101280123 12:103244969-103244991 AAGAGTCAACAGAAGCAAAGGGG + Intronic
1101824604 12:108210326-108210348 CTGAGGGAGGAGCAGCAGAGAGG - Intronic
1101981008 12:109406893-109406915 GGGAGGCAGCAGCAGCAGGGAGG - Intronic
1102049872 12:109854951-109854973 CAGAGGGAGCTGCAGCAGAAAGG + Intronic
1102218541 12:111179003-111179025 CAAAGCCAGCAGCAGCCAAGGGG + Intronic
1102241945 12:111329968-111329990 CACTGTCGGCAGCAGGAGAGGGG - Intronic
1102762311 12:115398693-115398715 CAGAGGCAGCAGGAGCTGGGAGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104355036 12:128077797-128077819 CAGATTCAGCAGAACCAGGGAGG + Intergenic
1104362485 12:128147100-128147122 CAGACTCGGTAACAGCAGAGAGG - Intergenic
1104853400 12:131889969-131889991 CAGAGACAAAAGCAGAAGAGAGG + Intergenic
1105242813 13:18622687-18622709 CAGAGGCACAAGCAGCAGATGGG + Intergenic
1105914965 13:24905850-24905872 GAGGGGCATCAGCAGCAGAGAGG - Exonic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106674890 13:31948015-31948037 TAGGGGCAGCAGCAGAAGAGGGG + Intergenic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1108022138 13:46138493-46138515 TGGAGACAGCAACAGCAGAGTGG + Intronic
1109274628 13:60290254-60290276 CAGCGTCAGCAGCAGCAACCAGG - Intergenic
1109416450 13:62046759-62046781 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1109555988 13:63976340-63976362 CAGATTCTGCAGCAGGAAAGGGG - Intergenic
1109837360 13:67877388-67877410 CTGAGTCTGCAGCAGCAGCTGGG - Intergenic
1112165766 13:96918541-96918563 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1112294780 13:98177086-98177108 CGGAGAGAGCAGCAGCAGCGGGG - Exonic
1113803272 13:113097135-113097157 CAGAGGCAGAAGCAGCACGGTGG - Intronic
1115912249 14:38269255-38269277 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1115923882 14:38409213-38409235 CAGAGGCAGCAGGATCAGTGTGG + Intergenic
1116079294 14:40153559-40153581 CACACCCAGCAGCAGCTGAGTGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1118654682 14:67933874-67933896 CTGACTCAGCAGGAGCATAGAGG - Intronic
1119762458 14:77161165-77161187 CAGAGCCAGCAGCAATGGAGGGG - Intronic
1120214673 14:81668932-81668954 CCGGGCCAGCAGCTGCAGAGGGG - Intergenic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121294918 14:92812348-92812370 AGAAGGCAGCAGCAGCAGAGAGG - Intronic
1121711050 14:96039452-96039474 CAGCGGCAGCGGCAGCAGCGAGG + Exonic
1122289457 14:100672390-100672412 CAGAGCAGACAGCAGCAGAGGGG + Intergenic
1122452918 14:101825771-101825793 CAGTGTCATCTTCAGCAGAGGGG + Intronic
1122459378 14:101882685-101882707 CAGGGTCGGCATGAGCAGAGCGG + Intronic
1122521728 14:102348854-102348876 CAGAATCAGCAACAGCACTGAGG + Intronic
1122843195 14:104476709-104476731 CAGATTCTTCCGCAGCAGAGTGG - Intronic
1122844767 14:104486882-104486904 CAGTGTCAGGAGCAGGCGAGGGG - Intronic
1122871326 14:104640409-104640431 CGGGGGCAGCTGCAGCAGAGGGG - Intergenic
1122993803 14:105251618-105251640 CACGGGCTGCAGCAGCAGAGGGG - Intronic
1123042822 14:105497349-105497371 CAGAGTCCGCAGCAGCTGGAAGG - Exonic
1123488490 15:20761917-20761939 CAGAGGCACTAGCAGCAGATGGG - Intergenic
1123544987 15:21330990-21331012 CAGAGGCACTAGCAGCAGATGGG - Intergenic
1124782840 15:32652134-32652156 CACTGTCAGGATCAGCAGAGAGG + Intronic
1125040928 15:35186478-35186500 CAGAGAGAGCAGGAGCTGAGGGG - Intergenic
1125672031 15:41480694-41480716 CAGGGTCAGAAGCAGCAGGCTGG - Exonic
1125904187 15:43375239-43375261 CAAAGTCAGAGGCAGTAGAGTGG + Intronic
1126915557 15:53462235-53462257 CTGAGGCAGCAACAGCAGTGGGG - Intergenic
1127401059 15:58586335-58586357 CAGTCTCAGCGGCAGCAGGGAGG - Intergenic
1127628059 15:60799762-60799784 CAGAGACTGCAATAGCAGAGAGG + Intronic
1127732473 15:61813569-61813591 CCGAGTCACCAGAAGCACAGAGG - Intergenic
1127844328 15:62856524-62856546 CAGGGTGGGCTGCAGCAGAGTGG + Intergenic
1128104620 15:65034364-65034386 CAGAGTCAGCTACATCAGATTGG - Intergenic
1128541287 15:68535568-68535590 GAGAGACAGGAGGAGCAGAGTGG - Intergenic
1128649741 15:69401772-69401794 AAGATTGAGCAGGAGCAGAGAGG - Intronic
1128719751 15:69939760-69939782 TTGGGGCAGCAGCAGCAGAGAGG + Intergenic
1129185701 15:73905024-73905046 CAAAGACCGTAGCAGCAGAGGGG + Intergenic
1129530641 15:76261571-76261593 CAGAGTCCGCAGCTGCAGGCAGG - Intronic
1130017977 15:80202018-80202040 CAGAGACAGCCACAGCAGTGGGG + Intergenic
1131032725 15:89199958-89199980 CCGAGGCAGCAGCAGCAGAGGGG - Exonic
1131188259 15:90293525-90293547 CAGAGTCTGCAGCAGCAGCGAGG + Intronic
1131388433 15:92027486-92027508 CACAGCCAGCAGCAGCAAAGAGG + Intronic
1131808269 15:96146122-96146144 CAGAGGAAGCAGAAGCAAAGGGG - Intergenic
1132087576 15:98920990-98921012 GCGCGGCAGCAGCAGCAGAGAGG - Intronic
1132153734 15:99480572-99480594 CACAGTCATCAGTGGCAGAGAGG - Intergenic
1132302411 15:100784204-100784226 CAGGGCAAGCTGCAGCAGAGGGG + Intergenic
1202953333 15_KI270727v1_random:58261-58283 CAGAGGCACTAGCAGCAGATGGG - Intergenic
1132533090 16:463267-463289 CAGAGTCAGCAGGTGCAGTGAGG + Intronic
1132581660 16:687476-687498 GACAGTCCGGAGCAGCAGAGCGG - Intronic
1132703053 16:1230109-1230131 CAGCGTCACCTGGAGCAGAGTGG - Intronic
1132705269 16:1240759-1240781 CAGCGTCACCTGGAGCAGAGTGG + Intronic
1132708397 16:1256122-1256144 CAGCGTCACCTGGAGCAGAGTGG + Exonic
1132739229 16:1403061-1403083 CAGAGCCTGCAGCAGCAGGGAGG + Intronic
1132757951 16:1495086-1495108 CCGCGTCAGCAGCAGGGGAGGGG + Intronic
1132984778 16:2759611-2759633 CAGAGTCAGCAGAAGTTGAACGG - Exonic
1133134330 16:3699176-3699198 CTGAGACTGCAGCTGCAGAGTGG - Intronic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1134191246 16:12122640-12122662 CAGAGGCTGGAGCGGCAGAGAGG + Intronic
1134790268 16:16983395-16983417 CAGAGGCATCAGCAACAGATAGG + Intergenic
1135328147 16:21540774-21540796 CAGAGACAGAAGCAGCACGGCGG - Intergenic
1135469374 16:22715719-22715741 TAGAGTCAGCTGCAGCTGACAGG - Intergenic
1135574020 16:23571237-23571259 CACAGGCAGCAGCAGCACGGCGG - Exonic
1135762238 16:25146742-25146764 CAGACCCAGAGGCAGCAGAGGGG - Intronic
1136067162 16:27766998-27767020 CTGAGTGAGAAGCAGCAGGGGGG + Intronic
1136338500 16:29626794-29626816 CAGAGACAGAAGCAGCACGGCGG - Intergenic
1136511693 16:30741807-30741829 CGGAGCCAGCAGCAGCGGATGGG - Intronic
1137545891 16:49403123-49403145 AAGGGACAGCTGCAGCAGAGGGG + Intergenic
1137775014 16:51047213-51047235 CAGAAGCAGCAGCAGCAGCTGGG + Intergenic
1138096853 16:54218708-54218730 CAGAGACAGCAGGTGCAGTGGGG + Intergenic
1138158456 16:54729136-54729158 CAGAGTCAGATGTAGCAGAGGGG - Intergenic
1138346988 16:56326175-56326197 CAGGGTGTGCACCAGCAGAGTGG - Intronic
1138799673 16:60012812-60012834 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1140070553 16:71645699-71645721 AAGAGCCAGCAGGAGCAGCGTGG - Exonic
1140123521 16:72102765-72102787 CAGAGTGAGCAGAAGAGGAGTGG - Intronic
1140420839 16:74817518-74817540 CAGAGAAAGCAGCAGCAGCCAGG - Intergenic
1140460865 16:75138714-75138736 CAGAGCCAGCCGCAGCAGCGAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141190803 16:81823287-81823309 CCGGGGCAGCTGCAGCAGAGAGG + Intronic
1141456939 16:84149057-84149079 CACAGCCAGCAGAAACAGAGTGG + Exonic
1141698980 16:85633816-85633838 CGGTGTCAGCAGCAGCAGGCAGG - Intronic
1142041237 16:87895708-87895730 CAGAGACAGAAGCAGCAGGGCGG - Intronic
1142204084 16:88774518-88774540 CAGAGTCCCCAGCAGCAGCCTGG + Intronic
1142563745 17:826379-826401 CATAGTCTGCAACAGCATAGGGG + Intronic
1143527978 17:7483354-7483376 CAGAGCCAGCAGCTGCGGTGGGG + Exonic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144287713 17:13794443-13794465 CAGAGTCAACAGGAGCTGTGTGG - Intergenic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144794915 17:17884546-17884568 CAAAGGCAGCAGCAGAAGGGTGG + Intronic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145207583 17:20992765-20992787 CAGTGTCTGCATCTGCAGAGTGG - Intergenic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145314829 17:21723404-21723426 CAGAGGCGGCAGCAGGAGTGGGG - Intergenic
1145713270 17:26995341-26995363 CAGAGGCGGCAGCAGGAGCGGGG - Intergenic
1145986216 17:29048703-29048725 AAGAAACAGCAGCTGCAGAGGGG - Intronic
1146588868 17:34110438-34110460 CTGAGGCAGCGGCAGCAGAGAGG - Intronic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147543050 17:41377246-41377268 GCAAGGCAGCAGCAGCAGAGAGG + Intronic
1147732871 17:42614714-42614736 CAGGGCCAGCAGATGCAGAGAGG - Intronic
1147772472 17:42877560-42877582 AAGTGTCAGCAGCAGCCCAGGGG + Intergenic
1147991434 17:44336085-44336107 CAGAGATAGCAGGAGCAGACAGG - Intergenic
1148215854 17:45833728-45833750 GAGGGGCAGCAGCACCAGAGTGG - Exonic
1148540627 17:48477578-48477600 CAGAGGCAGATGCAACAGAGAGG - Intergenic
1148881567 17:50731905-50731927 CAGAGTCTGAAGAAGCTGAGAGG + Intronic
1148980960 17:51574551-51574573 GAGGGCCAGCAGAAGCAGAGTGG + Intergenic
1152781723 17:82229830-82229852 AAGAGACAGGAGCCGCAGAGTGG + Intronic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154446124 18:14437190-14437212 CAGAGGCACAAGCAGCAGATGGG - Intergenic
1155074451 18:22342382-22342404 CAGAGAGAGGAGAAGCAGAGAGG + Intergenic
1155482242 18:26301862-26301884 CAGAGCCAGCAGCTGCTAAGAGG - Intronic
1156294067 18:35774106-35774128 CAGAAGCTGCAGCAGCAGAGGGG - Intergenic
1156656924 18:39299317-39299339 CAGAGTAGGCCGCAGCTGAGGGG + Intergenic
1157130816 18:45005749-45005771 GAGAGGCTGCAGCAGCAGAATGG - Intronic
1157478545 18:48038271-48038293 GAGAATCTGCAGGAGCAGAGGGG - Intronic
1157713929 18:49869493-49869515 CTAAGTCAACAGCAGCAGAGTGG + Intronic
1159200166 18:65173413-65173435 CAGAGTCAGAGGCTGCAGCGAGG + Intergenic
1159201918 18:65197518-65197540 CAAAGTCAGAAGCTGCAAAGAGG + Intergenic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160676195 19:392625-392647 CAGAGAGAGCTGCTGCAGAGAGG - Intergenic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1161327418 19:3670457-3670479 CGGAGGCACCAGGAGCAGAGGGG + Intronic
1163157138 19:15445733-15445755 GAGAGGCAGGAGCTGCAGAGGGG + Intronic
1163284520 19:16338131-16338153 TAGACTGGGCAGCAGCAGAGAGG + Intergenic
1163326302 19:16605575-16605597 CAGAGAGAGCAGCAGGAAAGGGG + Intronic
1163715150 19:18868996-18869018 GAGGGTCACCAGCAGCAGCGAGG + Exonic
1163989799 19:20988043-20988065 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1164575134 19:29401469-29401491 CAGAGTGGGAGGCAGCAGAGTGG + Intergenic
1164581972 19:29440159-29440181 CCGGGCCAGCAGCTGCAGAGGGG + Intergenic
1164821665 19:31255696-31255718 CAGGCAGAGCAGCAGCAGAGGGG + Intergenic
1165386039 19:35511185-35511207 CAGAGTCAGAAGCAGTGGGGTGG + Intronic
1165649607 19:37474346-37474368 CATTGTTAGCAGGAGCAGAGAGG + Intronic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1165792935 19:38502816-38502838 CAGGGGCAGGGGCAGCAGAGCGG + Intronic
1166297378 19:41895702-41895724 GAGACGCAGCACCAGCAGAGAGG - Intronic
1166310161 19:41958353-41958375 CAGAGCCACCAGCAACATAGGGG + Exonic
1167452968 19:49583233-49583255 CATATATAGCAGCAGCAGAGAGG - Exonic
1167488962 19:49780995-49781017 CAGGGACAGGAGAAGCAGAGAGG + Intronic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1167736048 19:51295137-51295159 CAGGGTCAGCTGCTGCAGCGGGG - Intergenic
1168110054 19:54187164-54187186 CAGCGTCAGCAGCAGCTGGACGG + Exonic
1168241496 19:55091304-55091326 CAGAGTCCCCAGGAGCCGAGGGG - Exonic
1168668656 19:58224364-58224386 CAGAGGCTGAAGCAGGAGAGTGG + Intergenic
1168714044 19:58516920-58516942 CGCTGTCAGCAGCAGCAGTGAGG + Exonic
1168721873 19:58558716-58558738 CCGAGTCCGCAGCTGCAGCGGGG - Exonic
925039458 2:719901-719923 CAAAGTCAGCATCAGCATGGAGG - Intergenic
925339491 2:3126297-3126319 AAGAGGCAGCAGGAGCAGTGTGG - Intergenic
925339523 2:3126515-3126537 CTCAACCAGCAGCAGCAGAGGGG + Intergenic
925952300 2:8926682-8926704 CAGAGTCTGAAGCAGAAAAGAGG + Intronic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926343198 2:11921863-11921885 CAGAGTCAGGAGAAACATAGAGG - Intergenic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
927195026 2:20541027-20541049 CAGATGGAGCAGCTGCAGAGGGG + Intergenic
927201525 2:20581129-20581151 CAGAGGCAGCAGCTGAACAGTGG - Intronic
927209610 2:20630952-20630974 CTGAGAGAGGAGCAGCAGAGGGG + Intronic
927826127 2:26311403-26311425 TTGAGTCAGCAGCGCCAGAGCGG + Exonic
928145724 2:28773369-28773391 AGGAGTGAGAAGCAGCAGAGAGG - Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928683069 2:33722596-33722618 CAGATTCTGCAGCAGCTCAGGGG - Intergenic
929719100 2:44348577-44348599 CAGAGCCAAAAGCAACAGAGCGG + Intronic
929776883 2:44935541-44935563 CAGGGTCAGCACCAGCAGCTCGG + Intergenic
929797761 2:45073042-45073064 CTGAGTCAGCCGCTGCAGGGAGG + Intergenic
930586719 2:53276123-53276145 CAGAGTCACCTGCTTCAGAGAGG - Intergenic
930660659 2:54049642-54049664 GGGAGTAAGAAGCAGCAGAGGGG - Intronic
930728933 2:54709359-54709381 CAGAGTGAGCAGCAGGAGCTGGG - Intergenic
930882643 2:56289507-56289529 CAGAGGGAGCAGCATGAGAGAGG + Intronic
932331854 2:70902151-70902173 CACACCCAGCAGCCGCAGAGAGG - Intronic
932646868 2:73511463-73511485 GAGGGTGAGCAGCAGCAGGGTGG - Intronic
933606991 2:84393629-84393651 CACAGACAGCAGAGGCAGAGTGG - Intergenic
933780419 2:85796927-85796949 CCGGGGCAGCAGCTGCAGAGGGG - Intergenic
934996564 2:98967135-98967157 CAGTGGCAGCAGCAGCACACTGG + Intergenic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
936147163 2:109987641-109987663 CGCTGTCAGCAGCAGCAGTGAGG + Intergenic
936153322 2:110033303-110033325 CAGTGTGGGCAGCAGCATAGTGG + Intergenic
936191359 2:110338112-110338134 CAGTGTGGGCAGCAGCATAGTGG - Intergenic
936197529 2:110383842-110383864 CGCTGTCAGCAGCAGCAGTGAGG - Intergenic
936935692 2:117836542-117836564 CAGAGTCAGCCGCAGACGGGAGG + Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937208865 2:120254214-120254236 CAGAGTCAGCAACTGTAGAAGGG + Intronic
937562644 2:123244619-123244641 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
937906022 2:127053224-127053246 CAGAGGGAGAAGCAGCAGAATGG + Intronic
938121984 2:128640472-128640494 CAGAGTCAGGACCAGCCCAGAGG + Intergenic
938126582 2:128677996-128678018 CAGAGCCAGGAGTAGCAGAGGGG - Intergenic
938319161 2:130351549-130351571 CCTGGTCAGCAGCAGCAGTGAGG + Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
939200293 2:139025203-139025225 CAGAGTGAGCAGCAGCACTCAGG - Intergenic
939668115 2:144975728-144975750 CAGATTATTCAGCAGCAGAGAGG - Intergenic
939962823 2:148580896-148580918 CATAGTCAGTCGCAGCAAAGAGG + Intergenic
939967814 2:148627788-148627810 CAGAGTATGCAGCAACATAGTGG - Intergenic
940030639 2:149257941-149257963 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
940848013 2:158661902-158661924 CACAGGCAGCAGCAGCAGGAGGG - Intronic
941001238 2:160205568-160205590 CGAAGTCAGGACCAGCAGAGGGG - Intronic
942224796 2:173805586-173805608 CAGAATCAGAATCAGCAGGGTGG - Intergenic
942242009 2:173971595-173971617 CACAGACAGAAGCATCAGAGGGG - Intergenic
943240465 2:185377314-185377336 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
944051372 2:195473928-195473950 CCAAGGCAGCAGCGGCAGAGTGG + Intergenic
944154137 2:196593222-196593244 TCGAGTCAGCAGCGGCAGCGGGG + Intronic
944817776 2:203396777-203396799 CAGAGCCAGCAGGGGCTGAGGGG - Exonic
944901768 2:204223201-204223223 CAGGGTGACCAACAGCAGAGAGG - Intergenic
945079840 2:206077818-206077840 CAGTGTCAGATGCTGCAGAGAGG - Intronic
946180755 2:217947544-217947566 CAGAGCCTGGAGCAACAGAGAGG + Intronic
946280901 2:218664791-218664813 CAGAGGCAGCAGGAGCGGGGGGG - Exonic
947033424 2:225824398-225824420 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
947544891 2:231003549-231003571 CAGAGTTAGTCTCAGCAGAGGGG + Intronic
947759993 2:232597176-232597198 CAGAGTCAACAGCATCAGTGAGG + Intergenic
947827067 2:233113746-233113768 GAGATGCAGCAGCAGGAGAGAGG - Intronic
948164703 2:235852031-235852053 CAGAGTCGGCAGCAGCTCACAGG - Intronic
948281188 2:236749038-236749060 CAGCGTGAGCAGCTGCAGGGAGG - Intergenic
948655138 2:239471893-239471915 AAGAGTTTTCAGCAGCAGAGTGG + Intergenic
948806368 2:240455047-240455069 CTTAGTGAGGAGCAGCAGAGTGG + Intronic
949055192 2:241924168-241924190 CAGAGTCACCACCAGCACAAAGG - Intergenic
1169111295 20:3035892-3035914 CAGAAGCAGCAGCAGCAGTCAGG + Exonic
1169197479 20:3691364-3691386 CAGAGGCAGCAGCCCCAGTGGGG + Exonic
1169379730 20:5096110-5096132 CAGAGCCAGCGGCAGGAGCGAGG - Intronic
1169477090 20:5941297-5941319 CAAAGACAGCAGCAGGGGAGTGG + Exonic
1169644507 20:7794877-7794899 TAGATTCAGGAGCAGAAGAGTGG + Intergenic
1169975099 20:11316419-11316441 CTGAATCAGCATCACCAGAGTGG - Intergenic
1171037353 20:21726340-21726362 CAGAGTCACCACCAGCAGGAAGG - Intergenic
1171278759 20:23879635-23879657 GGCAGTCAGCAGCAGCAGTGGGG + Exonic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172225988 20:33305720-33305742 CAAATTCAGCTGCAACAGAGTGG + Intronic
1172582957 20:36063265-36063287 CATAGTCAGCAGAAGCAAAGAGG + Intergenic
1173269352 20:41517804-41517826 CAAAGTCAGCAGCAGGGCAGAGG + Intronic
1173674005 20:44818071-44818093 CAGAGGCAGAAACAGGAGAGAGG + Intergenic
1174371303 20:50089994-50090016 AGGTGCCAGCAGCAGCAGAGGGG + Intronic
1174732710 20:52933447-52933469 TAGAGTCAGGTGCAGCAGTGTGG - Intergenic
1175040031 20:56040291-56040313 CCAAGTCAGCATTAGCAGAGTGG - Intergenic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175842723 20:62040426-62040448 CAGTGACAGCAGCAGCTCAGTGG + Intronic
1175874596 20:62223404-62223426 CAGAGGCAGCAGCAGCAGGTGGG - Intergenic
1176449856 21:6852656-6852678 CAGAGGCACAAGCAGCAGATGGG + Intergenic
1176798622 21:13397967-13397989 CAGAAGCAGCAGCTGCATAGTGG - Intergenic
1176828028 21:13717680-13717702 CAGAGGCACAAGCAGCAGATGGG + Intergenic
1178615069 21:34125455-34125477 CACAGTCAGCAGCACAACAGAGG + Exonic
1178801210 21:35797561-35797583 CACAGGTAGCAGCAGCAGTGTGG - Intronic
1179889665 21:44329165-44329187 CAGAGCCAGCTGCAGCACTGGGG - Intronic
1179974680 21:44857716-44857738 CAGCGTCCGGGGCAGCAGAGGGG - Intronic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1181079092 22:20401868-20401890 CAGAGTCAGCATCAGCATTAGGG + Intronic
1181875369 22:25936248-25936270 CAGATTCATCATCACCAGAGAGG + Intronic
1182159801 22:28110185-28110207 AGGAGTCAGGACCAGCAGAGTGG - Intronic
1182945556 22:34318094-34318116 CAGATTAAGCGGCAGAAGAGAGG + Intergenic
1183512167 22:38242681-38242703 CAGAGGCAGCTGCAAGAGAGGGG + Intronic
1183782303 22:40006754-40006776 CAGAGTCCGGAGCCGCTGAGTGG + Intronic
1184069349 22:42138422-42138444 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
1184102402 22:42347719-42347741 CAGCGCCAGCAGGGGCAGAGGGG + Intergenic
1184381414 22:44147098-44147120 CAGTGTCAGCAGGAGCAGCTGGG + Intronic
1184405189 22:44296894-44296916 CAGAGTCACCAGGCTCAGAGGGG + Intronic
1184742060 22:46434321-46434343 CTGAGTCAGCAGCAGCAGCTGGG + Intronic
1184782915 22:46658086-46658108 CTGACTCAGAAACAGCAGAGGGG - Intronic
1184840146 22:47047860-47047882 CAGAGTCTGCAGCAGAAAACAGG - Intronic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185000826 22:48244607-48244629 CAGAGTCAGCAGGGCCACAGTGG + Intergenic
1185023094 22:48391966-48391988 TAGAGTCAGGAGGAGAAGAGGGG + Intergenic
1185280818 22:49969146-49969168 CAGAGCCAGCCTCAGCACAGTGG - Intergenic
1185340699 22:50289669-50289691 CAGAGACAGCCGGAGCAGTGGGG - Exonic
949594668 3:5531270-5531292 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
949739283 3:7211828-7211850 TACTGTCAGCTGCAGCAGAGGGG - Intronic
950847463 3:16028825-16028847 CTGAGTGAGAAGTAGCAGAGAGG - Intergenic
951505824 3:23443985-23444007 CACGGTCAGCTGCAGCAGAAGGG - Intronic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
952747056 3:36791368-36791390 CAGAATCAGCAGAAGAGGAGTGG - Intergenic
953688600 3:45098051-45098073 CAGGGACTGCAGAAGCAGAGGGG - Intronic
953735644 3:45491871-45491893 CAGAGTTAGCACCAGGAGGGAGG - Intronic
954293856 3:49663487-49663509 CAGACACAGCAGCAGCAGCAAGG + Exonic
954419869 3:50413112-50413134 CAGCGGCAGCAGCAGCTGGGTGG - Intronic
954994838 3:54871881-54871903 TGGAGTCATCAGCTGCAGAGGGG - Intronic
955741401 3:62094803-62094825 AAGTTTCAGCAGCAGCTGAGGGG - Intronic
955920026 3:63945948-63945970 CAGAGTAACCAGATGCAGAGAGG + Intronic
958648378 3:96902707-96902729 CAGAGCCAGAAGCAGAAGAGGGG + Intronic
959134321 3:102398072-102398094 TAGATTCAGCAGTAGCAAAGAGG + Intronic
959278136 3:104304157-104304179 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
959484310 3:106909175-106909197 CAGAGCTACCAGCTGCAGAGAGG + Intergenic
960246284 3:115403941-115403963 CAGAGTCAGCAGGAGCTTAAGGG + Intergenic
960623720 3:119660399-119660421 GAGCGCCAACAGCAGCAGAGTGG - Exonic
960764702 3:121112432-121112454 GAGAGCCAGCAAAAGCAGAGTGG - Intronic
961205448 3:125077779-125077801 CAGAGACAGGTGGAGCAGAGAGG - Intergenic
961315656 3:126033618-126033640 CAGAGTCATCAGCAGCAACCTGG - Exonic
961932318 3:130547280-130547302 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
962891141 3:139674037-139674059 CAGAGGCAGGGACAGCAGAGAGG + Intronic
963583336 3:147154226-147154248 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
963686943 3:148447636-148447658 TAGAGTCAGCAGCAGCAGTGTGG - Intergenic
963804896 3:149713739-149713761 CAGTGATAGCAGCAGCAGAGGGG + Intronic
963969277 3:151411431-151411453 CAGATTCAGCAGCAGCCGAGTGG + Exonic
964475609 3:157095373-157095395 CAGAGTCTGAAGCAGTCGAGAGG + Intergenic
965693061 3:171378120-171378142 CAGAGCCAGAAGCCCCAGAGAGG + Intronic
965720999 3:171662143-171662165 CAGACCAATCAGCAGCAGAGCGG + Exonic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
967152748 3:186664756-186664778 CAGAGCCAGCAGCATCAGAAGGG - Intronic
967814974 3:193790783-193790805 AAGGGTGAGCAGCAGCAGCGTGG + Intergenic
968073435 3:195802355-195802377 CCGAGTCAGCAGGGGCAGTGAGG - Intronic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968165358 3:196460379-196460401 CAGAGGTAGCAGCAGCAGCTGGG + Intergenic
968193513 3:196688531-196688553 CAGCGTGGGCAGCAGCAGCGTGG - Intronic
968584941 4:1411944-1411966 CAGAGTAACCACCAGCAGAGAGG - Intergenic
968584955 4:1412004-1412026 CGGAGTAACCACCAGCAGAGAGG - Intergenic
968584968 4:1412064-1412086 CGGAGTAACCACCAGCAGAGAGG - Intergenic
969043582 4:4320327-4320349 CAGAGTGAGCAGAAGCTGTGAGG + Intronic
969209136 4:5672951-5672973 CAGAGACAGAAGCAGATGAGTGG + Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
971458024 4:26861730-26861752 AAAAGTCAGCAGCAGCATTGCGG + Intronic
972642950 4:40942346-40942368 TACAGTGAGCAGCAGAAGAGAGG + Intronic
973045386 4:45530596-45530618 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
973321707 4:48817134-48817156 GAGAGTAAGCAGAAGCAGTGTGG + Intronic
973766557 4:54168381-54168403 CAGCGTTAGCAGAGGCAGAGTGG - Intronic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974560014 4:63505805-63505827 GAGAGTGAGCAGAAGCAGAGTGG + Intergenic
975099408 4:70495255-70495277 CAGAGTCATCATCAGCTAAGAGG + Intergenic
975131872 4:70839510-70839532 CAGCGACTGCGGCAGCAGAGAGG + Exonic
975177822 4:71308569-71308591 GAGGGTGAGCAGAAGCAGAGGGG + Intronic
975495886 4:75035561-75035583 GAGAGGAGGCAGCAGCAGAGTGG - Intronic
975719241 4:77234201-77234223 CAGAATAAGCGGCAGCAGACTGG - Intronic
976140997 4:81991491-81991513 TAGAGGCAGCAGCAGCAGTGGGG + Intronic
977696577 4:99972237-99972259 CAGAGGCAGCAGCAGCACAGGGG - Intergenic
978326620 4:107564599-107564621 CAGAGATGACAGCAGCAGAGAGG + Intergenic
978466256 4:109012617-109012639 CTGGGCCAGCAGCTGCAGAGGGG + Intronic
978514611 4:109557544-109557566 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
979023045 4:115526975-115526997 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
979678613 4:123435590-123435612 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
980151736 4:129056080-129056102 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
980865913 4:138553284-138553306 CCGAGGCAGCAGCTGCCGAGGGG + Intergenic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
982223040 4:153141067-153141089 TAGAGTCAGGAGCAACAGGGAGG - Intergenic
982841635 4:160195026-160195048 CAGAGGCAGCCTCAGCAGATGGG + Intergenic
982848079 4:160276409-160276431 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
983523679 4:168737922-168737944 CAGAGACAGCAGCAGCTGTGAGG + Intronic
983721803 4:170863615-170863637 CACAGTCAGCAGTCACAGAGTGG - Intergenic
984413000 4:179419433-179419455 CAGAGTCAGGAGCAGAAGAAAGG + Intergenic
984805342 4:183746661-183746683 CCGGGCCAGCAGCTGCAGAGGGG - Intergenic
985317328 4:188672336-188672358 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
985324705 4:188754639-188754661 CCCAGCCAGCAGCTGCAGAGGGG + Intergenic
985656420 5:1133853-1133875 CCGAGGCAGCAACACCAGAGAGG + Intergenic
985778017 5:1855311-1855333 CAGAGGCAGCAGGAGCTGAAAGG + Intergenic
985861622 5:2476024-2476046 AAAACTCAGCAGAAGCAGAGGGG + Intergenic
985923615 5:2998858-2998880 CAGAGACAGCAGGAGGGGAGAGG + Intergenic
985940534 5:3132262-3132284 CAAAGTCAACAGCAGCAGAGAGG + Intergenic
985948907 5:3208064-3208086 CAGTGTAATCAACAGCAGAGGGG + Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
988204007 5:28110806-28110828 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
989987205 5:50714780-50714802 CACAGTCAGCTGCAGGAGGGAGG - Intronic
990009788 5:50983041-50983063 CAGAGGCAACAGAAGCAGAGAGG - Intergenic
990355216 5:54960270-54960292 CACAGTCAGCCCCAGCAGAAAGG + Intergenic
991332824 5:65510940-65510962 CAGAGTCACCAGCAGCAAGAGGG + Intergenic
991491743 5:67190533-67190555 TGGAGCCAGCAGAAGCAGAGAGG - Intronic
991651982 5:68865097-68865119 GAGAGTGGGCAGAAGCAGAGTGG + Intergenic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
991741101 5:69676346-69676368 GGGATTCAGCAGCAGCAGTGTGG - Intergenic
991756517 5:69878096-69878118 GGGATTCAGCAGCAGCAGTGTGG + Intergenic
991792675 5:70256083-70256105 GGGATTCAGCAGCAGCAGTGTGG - Intergenic
991820561 5:70552419-70552441 GGGATTCAGCAGCAGCAGTGTGG - Intergenic
991835919 5:70754009-70754031 GGGATTCAGCAGCAGCAGTGTGG + Intergenic
991885125 5:71256391-71256413 GGGATTCAGCAGCAGCAGTGTGG - Intergenic
992332353 5:75730284-75730306 CAGTGCCTGCATCAGCAGAGTGG - Intergenic
993900406 5:93580648-93580670 CAGAGGCAGCAGGCGGAGAGAGG - Intergenic
994850901 5:105053683-105053705 GAGGGTCAGCAGAAGCAGAGTGG - Intergenic
995551414 5:113285499-113285521 CAGAGTGAGCAGGGGGAGAGTGG - Intronic
995571994 5:113490349-113490371 CAGAGTCCCCACCAGCAGGGTGG + Intergenic
995785816 5:115826197-115826219 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
996428104 5:123336701-123336723 GACAGGCAGCTGCAGCAGAGGGG - Intergenic
996549237 5:124712517-124712539 AAGAGTGAGAAGGAGCAGAGTGG + Intronic
996747092 5:126854748-126854770 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
997125713 5:131224949-131224971 TAGAGGCAGAAGCAGCAGACTGG + Intergenic
997384836 5:133464500-133464522 CAAACACAGCATCAGCAGAGGGG + Intronic
997812011 5:136979575-136979597 CAGGGTCAGCAGCAGAGGATGGG + Intronic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998042565 5:138961593-138961615 CAGTGTCAGGAGCACCAGATGGG - Intronic
998723163 5:144976784-144976806 CAGAGTAGACAGCAGCAGAATGG - Intergenic
999221120 5:149978627-149978649 CAGAGTCAGCATTAGCAGTTAGG + Intronic
1000786440 5:165550046-165550068 CAGGGTGAGCTGAAGCAGAGTGG - Intergenic
1001158800 5:169296452-169296474 CAGACTAAGGAGCAGCTGAGTGG - Intronic
1001407271 5:171484909-171484931 CAGAGTCAGCCACTGCAGTGGGG + Intergenic
1001855213 5:175004821-175004843 CCCAGGCAGCATCAGCAGAGGGG + Intergenic
1002395676 5:178951661-178951683 CACAGCCAGCAGCAGGAGACTGG - Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1003304319 6:4912727-4912749 CAGAGTCCTCACCAGCAAAGAGG - Intronic
1003328160 6:5108551-5108573 CTGAGTCAGAATCTGCAGAGAGG + Exonic
1003460527 6:6324077-6324099 CACAATTAGCAACAGCAGAGAGG + Intergenic
1003564757 6:7213708-7213730 CAGAGGCAGAAACAGCACAGGGG + Intronic
1003564920 6:7214709-7214731 CAGAGGCAGCAGAACCACAGTGG + Intronic
1003938745 6:11003120-11003142 AAGTGACAGCAGCAGCAGAAGGG - Intronic
1004142268 6:13029312-13029334 CAGAGTCTTCAGCAGAGGAGTGG + Intronic
1004613284 6:17266496-17266518 TAGAGTCTGCAGCAGCTGTGTGG - Intergenic
1005321143 6:24655617-24655639 CAGAGTCACCAGCCACAGGGAGG + Intronic
1005551489 6:26922322-26922344 GGGATTCAGCAGCAGCAGTGTGG - Intergenic
1006133348 6:31881619-31881641 AAGAGACAGCTTCAGCAGAGTGG + Intronic
1006187866 6:32190809-32190831 CAGACTCAGCAGCAGTGGGGAGG + Exonic
1007370746 6:41425644-41425666 CAGAGAAAGCCTCAGCAGAGAGG + Intergenic
1007503053 6:42313241-42313263 CTGAGTCATCTGAAGCAGAGAGG + Intronic
1008071832 6:47105984-47106006 CAGAGGCAGCAGCAACAATGAGG + Intergenic
1008686722 6:53933328-53933350 CAGAGTCAAATGCAGCAGACAGG - Intronic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1010162883 6:72878932-72878954 AAGACTCAGCGGCAGCTGAGAGG - Intronic
1011572858 6:88758678-88758700 CAGAGTTAACATCAGCAGTGAGG - Intronic
1011791226 6:90901306-90901328 TAGTGTCAACTGCAGCAGAGCGG - Intergenic
1012382002 6:98631213-98631235 TGGACTCAGCAGCATCAGAGAGG + Intergenic
1012439064 6:99245422-99245444 CAGAGTCATGTGCTGCAGAGTGG - Intergenic
1012556744 6:100522590-100522612 CAGAGACAGGGGAAGCAGAGTGG + Intronic
1013086330 6:106861080-106861102 CAGGATAAGCAGCTGCAGAGAGG - Intergenic
1013576075 6:111483932-111483954 CAGACACTGCAGCAGCAAAGAGG - Intergenic
1014494177 6:122100140-122100162 CGGAGCCAGCAGCAGCAATGTGG + Intergenic
1015868445 6:137751804-137751826 AAGAATAAGCAGCAGCAGAAGGG + Intergenic
1016318955 6:142821223-142821245 CAGAGACAGCTCCAGCAGACTGG + Intronic
1019312234 7:368514-368536 CACAGTCGGCAGCAACAGAGGGG + Intergenic
1019527688 7:1488046-1488068 CAGAGGCAGCAGCAGCCGTAGGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021502438 7:21345795-21345817 GACAGTCAGCAGAAGCAGGGTGG - Intergenic
1022073125 7:26937461-26937483 CATAATCAGAAGCAGCAGAATGG + Intronic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1023164375 7:37328747-37328769 CAGAGTGAGCTTGAGCAGAGAGG - Intronic
1023451828 7:40294401-40294423 GAAAGGAAGCAGCAGCAGAGAGG + Intronic
1023870862 7:44262382-44262404 CAGAGTCAGCTGCTCCACAGGGG - Intronic
1023979770 7:45061988-45062010 TAGAGCCAGCACCAGCAGAGAGG - Intronic
1024632664 7:51262399-51262421 CAGAGTCAGAAGCTGAAGAGAGG + Intronic
1025072320 7:55910952-55910974 CACAGTCAGGAGAAGCAGACGGG - Intronic
1025714316 7:63941108-63941130 GAGGGTTAGCAGAAGCAGAGTGG + Intergenic
1026540404 7:71275208-71275230 CAGAGTCAGAAGTTGCAGGGGGG + Intronic
1027314710 7:76978455-76978477 CAGAGTCAGCCTCAGCGCAGGGG - Intergenic
1028253728 7:88566339-88566361 CAGAGGCCTCAGCAGCTGAGGGG + Intergenic
1028477190 7:91265154-91265176 CCGCCTCAGCAGCAACAGAGCGG + Exonic
1028963608 7:96776971-96776993 CAGAAGCAGTGGCAGCAGAGAGG + Intergenic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1030008109 7:105138343-105138365 CATGGCCAGCAGGAGCAGAGGGG + Intronic
1030344111 7:108413908-108413930 CAGAGCCATCAGCTACAGAGAGG - Intronic
1030595218 7:111530046-111530068 CAGAAGCAGCATCAGCAAAGAGG + Intronic
1030757994 7:113313310-113313332 CAGAGACACCAGTAGCAGAAAGG + Intergenic
1031125317 7:117767003-117767025 CAGAGGCCCCAGCAGCATAGGGG + Intronic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1032097585 7:128947296-128947318 CAGAGTGGGCGGCTGCAGAGTGG - Exonic
1032097589 7:128947311-128947333 CAGAGTAGGCGGCCGCAGAGTGG - Exonic
1032162676 7:129522793-129522815 CAAGGACAGCAGCAGCAGCGTGG + Intergenic
1032271013 7:130405924-130405946 CAGACACCGCAGAAGCAGAGAGG + Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1033652688 7:143354539-143354561 CAGAGCCTGCAGCAGGAGACGGG + Exonic
1034421822 7:150994718-150994740 CAGAGCCACCAGCGGCAGGGAGG - Intronic
1035316112 7:157998330-157998352 CAGAGCCAGGAGCAGCAGTCAGG + Intronic
1035356515 7:158279105-158279127 CAGAGCCAGCAGCAGCAAACCGG - Intronic
1035489852 7:159265393-159265415 TAGTGTCAGCATCAGCACAGAGG + Intergenic
1035866539 8:3089183-3089205 CCGAGGCTGCACCAGCAGAGTGG - Intronic
1035995967 8:4547237-4547259 CAGACTCAGCAGCCGCAGGAAGG - Intronic
1036126137 8:6064385-6064407 CAGATACATCAGTAGCAGAGAGG + Intergenic
1036282952 8:7417195-7417217 CAGAGTGGGCAGCAGGTGAGTGG - Intergenic
1036338516 8:7894323-7894345 CAGAGTGGGCAGCAGGTGAGTGG + Intergenic
1036743649 8:11389091-11389113 CAGACTCAGCACCTGCGGAGGGG + Intergenic
1037745420 8:21640182-21640204 CACAGCTAGCAGCAGCAGAACGG - Intergenic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1038068815 8:23991244-23991266 CAGAGTCAGCAGCAACTTACTGG - Intergenic
1038069094 8:23993435-23993457 CAGAGTCAGAAGTAGCAGTTAGG - Intergenic
1038456182 8:27673210-27673232 CAGAGAGAGCAGGAACAGAGGGG + Intronic
1039411733 8:37360463-37360485 GAGAGGCAGCAGCAGGAGAGAGG + Intergenic
1040003698 8:42600286-42600308 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1040104140 8:43530743-43530765 CAGAGTCTGCAGGTGCACAGAGG + Intergenic
1040911066 8:52519709-52519731 CAGAGTAAGTAGCAGGAGATGGG - Intergenic
1041149749 8:54919265-54919287 CAGGGTCAGGAGCAGAACAGAGG - Intergenic
1041153971 8:54964503-54964525 CAGAGTCACCACCAGCAAAAAGG + Intergenic
1041167442 8:55103172-55103194 CAGCGGCAGCAACAGCAGCGGGG + Exonic
1041957515 8:63572470-63572492 AAGAGTCAGCAACAGCAAATAGG - Intergenic
1042110836 8:65379781-65379803 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1042169484 8:65978011-65978033 CTGGGTCAGCAGCTGCAGAGGGG - Intergenic
1042624978 8:70748204-70748226 CAGAGCCAGCAGGAGCAGGTGGG + Intronic
1042704752 8:71654364-71654386 GAGAATCATCAGCAACAGAGAGG + Intergenic
1042877725 8:73455190-73455212 CAGAGCCAGCCCAAGCAGAGCGG - Intronic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1044526015 8:93251792-93251814 CAGAGGCAGAAACAGCGGAGGGG + Intergenic
1044628782 8:94259850-94259872 CAGAGTCAGCAGAAGTCAAGTGG + Intronic
1045880095 8:107028691-107028713 AAGAATCTGCAGCAACAGAGTGG + Intergenic
1046260321 8:111758975-111758997 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1046521393 8:115330788-115330810 CCGGGCCAGCAGCTGCAGAGGGG - Intergenic
1046601050 8:116317284-116317306 GAGAGTCAGGAAAAGCAGAGTGG + Intergenic
1047416119 8:124665922-124665944 GAGACTCATCAGCAGTAGAGTGG - Intronic
1047508542 8:125498455-125498477 CAGAGACAGCAGCTACAGGGTGG - Intergenic
1047777857 8:128088389-128088411 CACTTTCAGCAGCAGCAGAGGGG + Intergenic
1048229109 8:132619889-132619911 CACCGTCAGCAGCAGGAGAGAGG + Intronic
1048377214 8:133833401-133833423 CAAAGTCAGGAGCAACCGAGTGG - Intergenic
1048912871 8:139152854-139152876 CAGAAACAGCAGCAGCACAGAGG - Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1049428048 8:142545990-142546012 CAGAGTCCTCACCAGCAGACAGG + Intergenic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1049849368 8:144822581-144822603 CAGACTCTGCAGCACCCGAGTGG - Intergenic
1050050921 9:1600718-1600740 CAGAGGCAGCTGCAGAAGAAGGG - Intergenic
1050294913 9:4195438-4195460 CCGGGCCAGCAGCTGCAGAGGGG + Intronic
1050881011 9:10700704-10700726 CAGTGTGAGCAGCAGCACTGTGG - Intergenic
1051322025 9:15914941-15914963 GAGGGTGAGCAGAAGCAGAGTGG - Intronic
1052566723 9:30162526-30162548 CAGAGCCAGCAGTAGCTGAAGGG + Intergenic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1054823561 9:69548141-69548163 CCAAGTCAGCAGCAGGAGAGGGG - Intronic
1056220710 9:84448310-84448332 CAGAGTCAGAAGTAGGAGACAGG + Intergenic
1056385358 9:86092362-86092384 CAGAGTCAGGAGAAGGAAAGAGG - Intronic
1057217383 9:93236607-93236629 CGGACTCAGAAGCAGCAGGGCGG - Intronic
1057453514 9:95187220-95187242 CAGATACAGCAGCATCAGATGGG - Intronic
1057470999 9:95356144-95356166 CAGAGAAAGCAACAGCAGAGAGG - Intergenic
1057474739 9:95388804-95388826 CAGATACAGCAGCATCAGATGGG + Intergenic
1058697893 9:107575106-107575128 CTGATTCAGCAGCCCCAGAGTGG + Intergenic
1058883843 9:109307940-109307962 CACGGTGAGCAGCAGCAGACTGG + Intronic
1059875269 9:118627821-118627843 CTGAGTCAGGAGCAGCAGCTGGG - Intergenic
1059918000 9:119125236-119125258 CACAGTCATCATCATCAGAGGGG + Intergenic
1060658318 9:125388008-125388030 CAGAGGCAGCAGCTACACAGAGG - Intergenic
1060723717 9:125994327-125994349 CAGCGCCAGCAGGAGCAGATGGG - Intergenic
1060848096 9:126853122-126853144 CTGGGTCAACATCAGCAGAGAGG + Intergenic
1060913676 9:127370852-127370874 GGGAGTCAGCAGCAGCACACTGG - Intronic
1061826710 9:133262411-133262433 CAGAGTCTGCAGGAGCAGTCGGG - Intronic
1061861014 9:133468860-133468882 CAGAGCCTGCAGCAGCTGTGTGG + Exonic
1062026829 9:134344414-134344436 CTGACTCAGCAGCTGCAGGGTGG + Intronic
1062039959 9:134400002-134400024 CAGAGGCAGCAGGAACACAGAGG - Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062090099 9:134671567-134671589 CTGAGTCAGCAGAGCCAGAGAGG + Intronic
1062333738 9:136055934-136055956 TGGAGTCAGCAGGAGCACAGGGG + Intronic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1203519328 Un_GL000213v1:31861-31883 CAGAGGCACAAGCAGCAGATGGG - Intergenic
1185922507 X:4109244-4109266 CAGATTCAGCAGCATTGGAGTGG - Intergenic
1186508395 X:10111823-10111845 CAGTGTCATCAGCAGCAAATGGG + Intronic
1186872954 X:13790379-13790401 CAGTGTCAGCTTCAGCAGGGAGG + Intronic
1187263077 X:17705048-17705070 TGGCGTCAGCAGCAGAAGAGTGG + Intronic
1187396101 X:18920911-18920933 CAGAGTTATCAGCACCAGATTGG + Intronic
1187620445 X:21047354-21047376 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1187627925 X:21137676-21137698 TATAGTCAGCAGCAGCAGACAGG - Intergenic
1187704549 X:21996631-21996653 AAAAGTCAGCAAAAGCAGAGGGG - Intergenic
1189131498 X:38502742-38502764 TAGAGACAGCAGCAGCACTGGGG + Intronic
1189558047 X:42165718-42165740 CAGTGGCAGCAGCAGCACGGTGG + Intergenic
1191766804 X:64706345-64706367 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1192998102 X:76533692-76533714 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1193010558 X:76670876-76670898 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1193915046 X:87353746-87353768 CAGAGGCAGCAGGAGCCAAGTGG - Intergenic
1194375545 X:93128331-93128353 CAGAGTCCCCACCAGCAGGGAGG + Intergenic
1194564961 X:95474127-95474149 CAGTGTCAACTGCAGGAGAGAGG - Intergenic
1195844358 X:109209872-109209894 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1198060648 X:133042490-133042512 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG + Intergenic
1198332606 X:135635447-135635469 CAGAGGCAGAAGCAGAAGATGGG + Intergenic
1198364920 X:135930507-135930529 CAGAGGCAGAAGCAGAAGATGGG + Intergenic
1198882747 X:141298875-141298897 CAGAGTCAGGGACAGCAGATAGG - Intergenic
1199171661 X:144740686-144740708 GAGGGTCAGGAGAAGCAGAGGGG - Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199830608 X:151545915-151545937 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1200834415 Y:7718864-7718886 CAGAGTCCGCAGGAGAAGAATGG - Intergenic
1200955319 Y:8938473-8938495 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
1201283113 Y:12357988-12358010 CAGAGTCCTCCGCAGCAGGGAGG + Intergenic
1201611801 Y:15851524-15851546 GAAAGTGAGCAGAAGCAGAGTGG + Intergenic
1201909967 Y:19124174-19124196 CAAAGACAGGAGCAGCAGAGGGG - Intergenic