ID: 982099865

View in Genome Browser
Species Human (GRCh38)
Location 4:151957440-151957462
Sequence GTGGGGTGGCCTCCTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982099857_982099865 16 Left 982099857 4:151957401-151957423 CCTGTGCTGGGCTTCAGAGAGAG No data
Right 982099865 4:151957440-151957462 GTGGGGTGGCCTCCTGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982099865 Original CRISPR GTGGGGTGGCCTCCTGCTGG TGG Intergenic