ID: 982103279

View in Genome Browser
Species Human (GRCh38)
Location 4:151989523-151989545
Sequence CTGTGTAACCACAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982103279_982103284 7 Left 982103279 4:151989523-151989545 CCTGCTTCCCTGTGGTTACACAG No data
Right 982103284 4:151989553-151989575 TGTCCAGCAAGCCCTGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982103279 Original CRISPR CTGTGTAACCACAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr