ID: 982103284

View in Genome Browser
Species Human (GRCh38)
Location 4:151989553-151989575
Sequence TGTCCAGCAAGCCCTGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982103281_982103284 -1 Left 982103281 4:151989531-151989553 CCTGTGGTTACACAGCCATGCCT No data
Right 982103284 4:151989553-151989575 TGTCCAGCAAGCCCTGAGATAGG No data
982103278_982103284 8 Left 982103278 4:151989522-151989544 CCCTGCTTCCCTGTGGTTACACA No data
Right 982103284 4:151989553-151989575 TGTCCAGCAAGCCCTGAGATAGG No data
982103274_982103284 25 Left 982103274 4:151989505-151989527 CCTGGCCCTTTCTCGAACCCTGC No data
Right 982103284 4:151989553-151989575 TGTCCAGCAAGCCCTGAGATAGG No data
982103279_982103284 7 Left 982103279 4:151989523-151989545 CCTGCTTCCCTGTGGTTACACAG No data
Right 982103284 4:151989553-151989575 TGTCCAGCAAGCCCTGAGATAGG No data
982103280_982103284 0 Left 982103280 4:151989530-151989552 CCCTGTGGTTACACAGCCATGCC No data
Right 982103284 4:151989553-151989575 TGTCCAGCAAGCCCTGAGATAGG No data
982103275_982103284 20 Left 982103275 4:151989510-151989532 CCCTTTCTCGAACCCTGCTTCCC No data
Right 982103284 4:151989553-151989575 TGTCCAGCAAGCCCTGAGATAGG No data
982103276_982103284 19 Left 982103276 4:151989511-151989533 CCTTTCTCGAACCCTGCTTCCCT No data
Right 982103284 4:151989553-151989575 TGTCCAGCAAGCCCTGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982103284 Original CRISPR TGTCCAGCAAGCCCTGAGAT AGG Intergenic
No off target data available for this crispr