ID: 982103446

View in Genome Browser
Species Human (GRCh38)
Location 4:151990910-151990932
Sequence TTGAATGCACAGAGACAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982103446_982103449 15 Left 982103446 4:151990910-151990932 CCCTGCTGTCTCTGTGCATTCAA No data
Right 982103449 4:151990948-151990970 GACTCCAGTCAGATTGGATTAGG 0: 6
1: 74
2: 501
3: 1253
4: 2014
982103446_982103450 16 Left 982103446 4:151990910-151990932 CCCTGCTGTCTCTGTGCATTCAA No data
Right 982103450 4:151990949-151990971 ACTCCAGTCAGATTGGATTAGGG 0: 3
1: 83
2: 520
3: 1356
4: 2073
982103446_982103452 29 Left 982103446 4:151990910-151990932 CCCTGCTGTCTCTGTGCATTCAA No data
Right 982103452 4:151990962-151990984 TGGATTAGGGCCCACCCTAATGG 0: 40
1: 99
2: 182
3: 236
4: 283
982103446_982103448 9 Left 982103446 4:151990910-151990932 CCCTGCTGTCTCTGTGCATTCAA No data
Right 982103448 4:151990942-151990964 TCTTATGACTCCAGTCAGATTGG 0: 2
1: 2
2: 7
3: 46
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982103446 Original CRISPR TTGAATGCACAGAGACAGCA GGG (reversed) Intergenic
No off target data available for this crispr