ID: 982103993

View in Genome Browser
Species Human (GRCh38)
Location 4:151995965-151995987
Sequence CAGGTTGTTTAACCAGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982103989_982103993 25 Left 982103989 4:151995917-151995939 CCACATTTTGGCATGACACAAAT No data
Right 982103993 4:151995965-151995987 CAGGTTGTTTAACCAGTTCAGGG No data
982103990_982103993 -4 Left 982103990 4:151995946-151995968 CCTTTCATTATTAACTGTGCAGG No data
Right 982103993 4:151995965-151995987 CAGGTTGTTTAACCAGTTCAGGG No data
982103988_982103993 26 Left 982103988 4:151995916-151995938 CCCACATTTTGGCATGACACAAA No data
Right 982103993 4:151995965-151995987 CAGGTTGTTTAACCAGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982103993 Original CRISPR CAGGTTGTTTAACCAGTTCA GGG Intergenic
No off target data available for this crispr