ID: 982105417

View in Genome Browser
Species Human (GRCh38)
Location 4:152007879-152007901
Sequence CAGAACACAGGAAAGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982105417_982105423 2 Left 982105417 4:152007879-152007901 CCTGCCGCCTTTCCTGTGTTCTG No data
Right 982105423 4:152007904-152007926 TGGTGCCTGTAAGATTGTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982105417 Original CRISPR CAGAACACAGGAAAGGCGGC AGG (reversed) Intergenic
No off target data available for this crispr