ID: 982105733

View in Genome Browser
Species Human (GRCh38)
Location 4:152010561-152010583
Sequence TGCTCTAGTTGGCGATGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982105733_982105743 22 Left 982105733 4:152010561-152010583 CCTCCTCATCGCCAACTAGAGCA No data
Right 982105743 4:152010606-152010628 AGCAAAATCTGCTGGTGCTATGG No data
982105733_982105736 -1 Left 982105733 4:152010561-152010583 CCTCCTCATCGCCAACTAGAGCA No data
Right 982105736 4:152010583-152010605 AGCCCCTTTGCCCGTCTGAAAGG No data
982105733_982105742 14 Left 982105733 4:152010561-152010583 CCTCCTCATCGCCAACTAGAGCA No data
Right 982105742 4:152010598-152010620 CTGAAAGGAGCAAAATCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982105733 Original CRISPR TGCTCTAGTTGGCGATGAGG AGG (reversed) Intergenic
No off target data available for this crispr