ID: 982105861

View in Genome Browser
Species Human (GRCh38)
Location 4:152011662-152011684
Sequence AACACGTGGCCACCTTCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982105855_982105861 17 Left 982105855 4:152011622-152011644 CCAGTTTTAGGAGTATCTACTCC No data
Right 982105861 4:152011662-152011684 AACACGTGGCCACCTTCTTCCGG No data
982105858_982105861 -4 Left 982105858 4:152011643-152011665 CCTGGCTTCCTGGATGATGAACA No data
Right 982105861 4:152011662-152011684 AACACGTGGCCACCTTCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982105861 Original CRISPR AACACGTGGCCACCTTCTTC CGG Intergenic
No off target data available for this crispr