ID: 982107311

View in Genome Browser
Species Human (GRCh38)
Location 4:152022261-152022283
Sequence AGATTGCCACCAAGCCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982107302_982107311 27 Left 982107302 4:152022211-152022233 CCCGCTTGGCAGAGGGTCAGCAG No data
Right 982107311 4:152022261-152022283 AGATTGCCACCAAGCCTTTGGGG No data
982107301_982107311 28 Left 982107301 4:152022210-152022232 CCCCGCTTGGCAGAGGGTCAGCA No data
Right 982107311 4:152022261-152022283 AGATTGCCACCAAGCCTTTGGGG No data
982107303_982107311 26 Left 982107303 4:152022212-152022234 CCGCTTGGCAGAGGGTCAGCAGC No data
Right 982107311 4:152022261-152022283 AGATTGCCACCAAGCCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982107311 Original CRISPR AGATTGCCACCAAGCCTTTG GGG Intergenic
No off target data available for this crispr