ID: 982107598

View in Genome Browser
Species Human (GRCh38)
Location 4:152024350-152024372
Sequence AAAGGTTTGAAGCAGGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982107598_982107609 28 Left 982107598 4:152024350-152024372 CCAAGTCCCTGCTTCAAACCTTT No data
Right 982107609 4:152024401-152024423 CTGGACTCTATGCAGATCGTGGG No data
982107598_982107604 9 Left 982107598 4:152024350-152024372 CCAAGTCCCTGCTTCAAACCTTT No data
Right 982107604 4:152024382-152024404 CTCTACCACCTCCTTAAGTCTGG No data
982107598_982107608 27 Left 982107598 4:152024350-152024372 CCAAGTCCCTGCTTCAAACCTTT No data
Right 982107608 4:152024400-152024422 TCTGGACTCTATGCAGATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982107598 Original CRISPR AAAGGTTTGAAGCAGGGACT TGG (reversed) Intergenic