ID: 982107599

View in Genome Browser
Species Human (GRCh38)
Location 4:152024356-152024378
Sequence CGATGAAAAGGTTTGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982107599_982107608 21 Left 982107599 4:152024356-152024378 CCCTGCTTCAAACCTTTTCATCG No data
Right 982107608 4:152024400-152024422 TCTGGACTCTATGCAGATCGTGG No data
982107599_982107604 3 Left 982107599 4:152024356-152024378 CCCTGCTTCAAACCTTTTCATCG No data
Right 982107604 4:152024382-152024404 CTCTACCACCTCCTTAAGTCTGG No data
982107599_982107610 25 Left 982107599 4:152024356-152024378 CCCTGCTTCAAACCTTTTCATCG No data
Right 982107610 4:152024404-152024426 GACTCTATGCAGATCGTGGGAGG No data
982107599_982107609 22 Left 982107599 4:152024356-152024378 CCCTGCTTCAAACCTTTTCATCG No data
Right 982107609 4:152024401-152024423 CTGGACTCTATGCAGATCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982107599 Original CRISPR CGATGAAAAGGTTTGAAGCA GGG (reversed) Intergenic