ID: 982107602

View in Genome Browser
Species Human (GRCh38)
Location 4:152024380-152024402
Sequence AGACTTAAGGAGGTGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982107602_982107611 9 Left 982107602 4:152024380-152024402 CCCTCTACCACCTCCTTAAGTCT No data
Right 982107611 4:152024412-152024434 GCAGATCGTGGGAGGTCTTCTGG No data
982107602_982107610 1 Left 982107602 4:152024380-152024402 CCCTCTACCACCTCCTTAAGTCT No data
Right 982107610 4:152024404-152024426 GACTCTATGCAGATCGTGGGAGG No data
982107602_982107612 10 Left 982107602 4:152024380-152024402 CCCTCTACCACCTCCTTAAGTCT No data
Right 982107612 4:152024413-152024435 CAGATCGTGGGAGGTCTTCTGGG No data
982107602_982107609 -2 Left 982107602 4:152024380-152024402 CCCTCTACCACCTCCTTAAGTCT No data
Right 982107609 4:152024401-152024423 CTGGACTCTATGCAGATCGTGGG No data
982107602_982107608 -3 Left 982107602 4:152024380-152024402 CCCTCTACCACCTCCTTAAGTCT No data
Right 982107608 4:152024400-152024422 TCTGGACTCTATGCAGATCGTGG No data
982107602_982107613 11 Left 982107602 4:152024380-152024402 CCCTCTACCACCTCCTTAAGTCT No data
Right 982107613 4:152024414-152024436 AGATCGTGGGAGGTCTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982107602 Original CRISPR AGACTTAAGGAGGTGGTAGA GGG (reversed) Intergenic