ID: 982107606

View in Genome Browser
Species Human (GRCh38)
Location 4:152024390-152024412
Sequence CATAGAGTCCAGACTTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982107606_982107611 -1 Left 982107606 4:152024390-152024412 CCTCCTTAAGTCTGGACTCTATG No data
Right 982107611 4:152024412-152024434 GCAGATCGTGGGAGGTCTTCTGG No data
982107606_982107612 0 Left 982107606 4:152024390-152024412 CCTCCTTAAGTCTGGACTCTATG No data
Right 982107612 4:152024413-152024435 CAGATCGTGGGAGGTCTTCTGGG No data
982107606_982107613 1 Left 982107606 4:152024390-152024412 CCTCCTTAAGTCTGGACTCTATG No data
Right 982107613 4:152024414-152024436 AGATCGTGGGAGGTCTTCTGGGG No data
982107606_982107610 -9 Left 982107606 4:152024390-152024412 CCTCCTTAAGTCTGGACTCTATG No data
Right 982107610 4:152024404-152024426 GACTCTATGCAGATCGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982107606 Original CRISPR CATAGAGTCCAGACTTAAGG AGG (reversed) Intergenic
No off target data available for this crispr