ID: 982107608

View in Genome Browser
Species Human (GRCh38)
Location 4:152024400-152024422
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982107601_982107608 9 Left 982107601 4:152024368-152024390 CCTTTTCATCGTCCCTCTACCAC No data
Right 982107608 4:152024400-152024422 TCTGGACTCTATGCAGATCGTGG No data
982107603_982107608 -4 Left 982107603 4:152024381-152024403 CCTCTACCACCTCCTTAAGTCTG No data
Right 982107608 4:152024400-152024422 TCTGGACTCTATGCAGATCGTGG No data
982107602_982107608 -3 Left 982107602 4:152024380-152024402 CCCTCTACCACCTCCTTAAGTCT No data
Right 982107608 4:152024400-152024422 TCTGGACTCTATGCAGATCGTGG No data
982107600_982107608 20 Left 982107600 4:152024357-152024379 CCTGCTTCAAACCTTTTCATCGT No data
Right 982107608 4:152024400-152024422 TCTGGACTCTATGCAGATCGTGG No data
982107598_982107608 27 Left 982107598 4:152024350-152024372 CCAAGTCCCTGCTTCAAACCTTT No data
Right 982107608 4:152024400-152024422 TCTGGACTCTATGCAGATCGTGG No data
982107599_982107608 21 Left 982107599 4:152024356-152024378 CCCTGCTTCAAACCTTTTCATCG No data
Right 982107608 4:152024400-152024422 TCTGGACTCTATGCAGATCGTGG No data
982107605_982107608 -10 Left 982107605 4:152024387-152024409 CCACCTCCTTAAGTCTGGACTCT No data
Right 982107608 4:152024400-152024422 TCTGGACTCTATGCAGATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type