ID: 982107610

View in Genome Browser
Species Human (GRCh38)
Location 4:152024404-152024426
Sequence GACTCTATGCAGATCGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982107603_982107610 0 Left 982107603 4:152024381-152024403 CCTCTACCACCTCCTTAAGTCTG No data
Right 982107610 4:152024404-152024426 GACTCTATGCAGATCGTGGGAGG No data
982107602_982107610 1 Left 982107602 4:152024380-152024402 CCCTCTACCACCTCCTTAAGTCT No data
Right 982107610 4:152024404-152024426 GACTCTATGCAGATCGTGGGAGG No data
982107601_982107610 13 Left 982107601 4:152024368-152024390 CCTTTTCATCGTCCCTCTACCAC No data
Right 982107610 4:152024404-152024426 GACTCTATGCAGATCGTGGGAGG No data
982107599_982107610 25 Left 982107599 4:152024356-152024378 CCCTGCTTCAAACCTTTTCATCG No data
Right 982107610 4:152024404-152024426 GACTCTATGCAGATCGTGGGAGG No data
982107606_982107610 -9 Left 982107606 4:152024390-152024412 CCTCCTTAAGTCTGGACTCTATG No data
Right 982107610 4:152024404-152024426 GACTCTATGCAGATCGTGGGAGG No data
982107605_982107610 -6 Left 982107605 4:152024387-152024409 CCACCTCCTTAAGTCTGGACTCT No data
Right 982107610 4:152024404-152024426 GACTCTATGCAGATCGTGGGAGG No data
982107600_982107610 24 Left 982107600 4:152024357-152024379 CCTGCTTCAAACCTTTTCATCGT No data
Right 982107610 4:152024404-152024426 GACTCTATGCAGATCGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982107610 Original CRISPR GACTCTATGCAGATCGTGGG AGG Intergenic
No off target data available for this crispr