ID: 982107612

View in Genome Browser
Species Human (GRCh38)
Location 4:152024413-152024435
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982107605_982107612 3 Left 982107605 4:152024387-152024409 CCACCTCCTTAAGTCTGGACTCT No data
Right 982107612 4:152024413-152024435 CAGATCGTGGGAGGTCTTCTGGG No data
982107603_982107612 9 Left 982107603 4:152024381-152024403 CCTCTACCACCTCCTTAAGTCTG No data
Right 982107612 4:152024413-152024435 CAGATCGTGGGAGGTCTTCTGGG No data
982107601_982107612 22 Left 982107601 4:152024368-152024390 CCTTTTCATCGTCCCTCTACCAC No data
Right 982107612 4:152024413-152024435 CAGATCGTGGGAGGTCTTCTGGG No data
982107602_982107612 10 Left 982107602 4:152024380-152024402 CCCTCTACCACCTCCTTAAGTCT No data
Right 982107612 4:152024413-152024435 CAGATCGTGGGAGGTCTTCTGGG No data
982107606_982107612 0 Left 982107606 4:152024390-152024412 CCTCCTTAAGTCTGGACTCTATG No data
Right 982107612 4:152024413-152024435 CAGATCGTGGGAGGTCTTCTGGG No data
982107607_982107612 -3 Left 982107607 4:152024393-152024415 CCTTAAGTCTGGACTCTATGCAG No data
Right 982107612 4:152024413-152024435 CAGATCGTGGGAGGTCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type