ID: 982108038

View in Genome Browser
Species Human (GRCh38)
Location 4:152028453-152028475
Sequence ACCCTTTGGCTCCACTGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982108038_982108042 -2 Left 982108038 4:152028453-152028475 CCAATCCAGTGGAGCCAAAGGGT No data
Right 982108042 4:152028474-152028496 GTGAGGCAGTATTTGAGTTGAGG No data
982108038_982108043 9 Left 982108038 4:152028453-152028475 CCAATCCAGTGGAGCCAAAGGGT No data
Right 982108043 4:152028485-152028507 TTTGAGTTGAGGCTCAAGAGCGG No data
982108038_982108044 10 Left 982108038 4:152028453-152028475 CCAATCCAGTGGAGCCAAAGGGT No data
Right 982108044 4:152028486-152028508 TTGAGTTGAGGCTCAAGAGCGGG No data
982108038_982108045 19 Left 982108038 4:152028453-152028475 CCAATCCAGTGGAGCCAAAGGGT No data
Right 982108045 4:152028495-152028517 GGCTCAAGAGCGGGAGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982108038 Original CRISPR ACCCTTTGGCTCCACTGGAT TGG (reversed) Intergenic
No off target data available for this crispr