ID: 982108042

View in Genome Browser
Species Human (GRCh38)
Location 4:152028474-152028496
Sequence GTGAGGCAGTATTTGAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982108040_982108042 -7 Left 982108040 4:152028458-152028480 CCAGTGGAGCCAAAGGGTGAGGC No data
Right 982108042 4:152028474-152028496 GTGAGGCAGTATTTGAGTTGAGG No data
982108035_982108042 4 Left 982108035 4:152028447-152028469 CCAAAGCCAATCCAGTGGAGCCA No data
Right 982108042 4:152028474-152028496 GTGAGGCAGTATTTGAGTTGAGG No data
982108038_982108042 -2 Left 982108038 4:152028453-152028475 CCAATCCAGTGGAGCCAAAGGGT No data
Right 982108042 4:152028474-152028496 GTGAGGCAGTATTTGAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982108042 Original CRISPR GTGAGGCAGTATTTGAGTTG AGG Intergenic