ID: 982108043

View in Genome Browser
Species Human (GRCh38)
Location 4:152028485-152028507
Sequence TTTGAGTTGAGGCTCAAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982108040_982108043 4 Left 982108040 4:152028458-152028480 CCAGTGGAGCCAAAGGGTGAGGC No data
Right 982108043 4:152028485-152028507 TTTGAGTTGAGGCTCAAGAGCGG No data
982108035_982108043 15 Left 982108035 4:152028447-152028469 CCAAAGCCAATCCAGTGGAGCCA No data
Right 982108043 4:152028485-152028507 TTTGAGTTGAGGCTCAAGAGCGG No data
982108038_982108043 9 Left 982108038 4:152028453-152028475 CCAATCCAGTGGAGCCAAAGGGT No data
Right 982108043 4:152028485-152028507 TTTGAGTTGAGGCTCAAGAGCGG No data
982108041_982108043 -5 Left 982108041 4:152028467-152028489 CCAAAGGGTGAGGCAGTATTTGA No data
Right 982108043 4:152028485-152028507 TTTGAGTTGAGGCTCAAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982108043 Original CRISPR TTTGAGTTGAGGCTCAAGAG CGG Intergenic