ID: 982109558

View in Genome Browser
Species Human (GRCh38)
Location 4:152041392-152041414
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982109555_982109558 0 Left 982109555 4:152041369-152041391 CCATTTTAAAAGTCTCTATTTTC No data
Right 982109558 4:152041392-152041414 CTCCAGCGTCTCCCTCCTGGTGG No data
982109554_982109558 22 Left 982109554 4:152041347-152041369 CCTGGGGTTTGGGTCATCAAAGC No data
Right 982109558 4:152041392-152041414 CTCCAGCGTCTCCCTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr