ID: 982117982

View in Genome Browser
Species Human (GRCh38)
Location 4:152113599-152113621
Sequence GATACTATTTCCTCTCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982117977_982117982 1 Left 982117977 4:152113575-152113597 CCCCATTGAGGAAGCTCCATACT No data
Right 982117982 4:152113599-152113621 GATACTATTTCCTCTCCTTCAGG No data
982117979_982117982 -1 Left 982117979 4:152113577-152113599 CCATTGAGGAAGCTCCATACTGG No data
Right 982117982 4:152113599-152113621 GATACTATTTCCTCTCCTTCAGG No data
982117978_982117982 0 Left 982117978 4:152113576-152113598 CCCATTGAGGAAGCTCCATACTG No data
Right 982117982 4:152113599-152113621 GATACTATTTCCTCTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982117982 Original CRISPR GATACTATTTCCTCTCCTTC AGG Intergenic
No off target data available for this crispr