ID: 982121053 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:152144290-152144312 |
| Sequence | TACTTTGAACTGAAGGAGGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 982121050_982121053 | 5 | Left | 982121050 | 4:152144262-152144284 | CCAAAGTATGGCACTTTGGCATG | 0: 13 1: 47 2: 134 3: 401 4: 752 |
||
| Right | 982121053 | 4:152144290-152144312 | TACTTTGAACTGAAGGAGGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 982121053 | Original CRISPR | TACTTTGAACTGAAGGAGGT TGG | Intergenic | ||
| No off target data available for this crispr | |||||