ID: 982121053

View in Genome Browser
Species Human (GRCh38)
Location 4:152144290-152144312
Sequence TACTTTGAACTGAAGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982121050_982121053 5 Left 982121050 4:152144262-152144284 CCAAAGTATGGCACTTTGGCATG 0: 13
1: 47
2: 134
3: 401
4: 752
Right 982121053 4:152144290-152144312 TACTTTGAACTGAAGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982121053 Original CRISPR TACTTTGAACTGAAGGAGGT TGG Intergenic
No off target data available for this crispr