ID: 982124294

View in Genome Browser
Species Human (GRCh38)
Location 4:152171154-152171176
Sequence GAGGACACTTGGGAGTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982124294_982124299 13 Left 982124294 4:152171154-152171176 CCCATCAACTCCCAAGTGTCCTC No data
Right 982124299 4:152171190-152171212 TCTTTCGCCAGCTTGCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982124294 Original CRISPR GAGGACACTTGGGAGTTGAT GGG (reversed) Intergenic
No off target data available for this crispr