ID: 982127311

View in Genome Browser
Species Human (GRCh38)
Location 4:152195634-152195656
Sequence CCACCCCAGTTTCCAACCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982127309_982127311 1 Left 982127309 4:152195610-152195632 CCTTAAGACTGCAACATAGAAAC No data
Right 982127311 4:152195634-152195656 CCACCCCAGTTTCCAACCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982127311 Original CRISPR CCACCCCAGTTTCCAACCTG CGG Intergenic
No off target data available for this crispr