ID: 982127804

View in Genome Browser
Species Human (GRCh38)
Location 4:152199526-152199548
Sequence CTGCTAGTAAGGGTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982127804_982127809 -7 Left 982127804 4:152199526-152199548 CCCAGCTCCACCCTTACTAGCAG No data
Right 982127809 4:152199542-152199564 CTAGCAGTGCCATGTTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982127804 Original CRISPR CTGCTAGTAAGGGTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr