ID: 982131438

View in Genome Browser
Species Human (GRCh38)
Location 4:152232421-152232443
Sequence CTGCATAGATTGGCAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982131438_982131442 0 Left 982131438 4:152232421-152232443 CCTTCTGCTGCCAATCTATGCAG No data
Right 982131442 4:152232444-152232466 GCTGGAACCCAAATCCTCAGTGG No data
982131438_982131447 22 Left 982131438 4:152232421-152232443 CCTTCTGCTGCCAATCTATGCAG No data
Right 982131447 4:152232466-152232488 GAGCATTGAGTATGAAATCTGGG No data
982131438_982131446 21 Left 982131438 4:152232421-152232443 CCTTCTGCTGCCAATCTATGCAG No data
Right 982131446 4:152232465-152232487 GGAGCATTGAGTATGAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982131438 Original CRISPR CTGCATAGATTGGCAGCAGA AGG (reversed) Intergenic
No off target data available for this crispr