ID: 982131441

View in Genome Browser
Species Human (GRCh38)
Location 4:152232431-152232453
Sequence GGGTTCCAGCCTGCATAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982131441_982131442 -10 Left 982131441 4:152232431-152232453 CCAATCTATGCAGGCTGGAACCC No data
Right 982131442 4:152232444-152232466 GCTGGAACCCAAATCCTCAGTGG No data
982131441_982131446 11 Left 982131441 4:152232431-152232453 CCAATCTATGCAGGCTGGAACCC No data
Right 982131446 4:152232465-152232487 GGAGCATTGAGTATGAAATCTGG No data
982131441_982131448 25 Left 982131441 4:152232431-152232453 CCAATCTATGCAGGCTGGAACCC No data
Right 982131448 4:152232479-152232501 GAAATCTGGGCATGTCTCTGAGG No data
982131441_982131447 12 Left 982131441 4:152232431-152232453 CCAATCTATGCAGGCTGGAACCC No data
Right 982131447 4:152232466-152232488 GAGCATTGAGTATGAAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982131441 Original CRISPR GGGTTCCAGCCTGCATAGAT TGG (reversed) Intergenic
No off target data available for this crispr