ID: 982131442

View in Genome Browser
Species Human (GRCh38)
Location 4:152232444-152232466
Sequence GCTGGAACCCAAATCCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982131441_982131442 -10 Left 982131441 4:152232431-152232453 CCAATCTATGCAGGCTGGAACCC No data
Right 982131442 4:152232444-152232466 GCTGGAACCCAAATCCTCAGTGG No data
982131438_982131442 0 Left 982131438 4:152232421-152232443 CCTTCTGCTGCCAATCTATGCAG No data
Right 982131442 4:152232444-152232466 GCTGGAACCCAAATCCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982131442 Original CRISPR GCTGGAACCCAAATCCTCAG TGG Intergenic
No off target data available for this crispr