ID: 982131447

View in Genome Browser
Species Human (GRCh38)
Location 4:152232466-152232488
Sequence GAGCATTGAGTATGAAATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982131441_982131447 12 Left 982131441 4:152232431-152232453 CCAATCTATGCAGGCTGGAACCC No data
Right 982131447 4:152232466-152232488 GAGCATTGAGTATGAAATCTGGG No data
982131444_982131447 -9 Left 982131444 4:152232452-152232474 CCAAATCCTCAGTGGAGCATTGA No data
Right 982131447 4:152232466-152232488 GAGCATTGAGTATGAAATCTGGG No data
982131443_982131447 -8 Left 982131443 4:152232451-152232473 CCCAAATCCTCAGTGGAGCATTG No data
Right 982131447 4:152232466-152232488 GAGCATTGAGTATGAAATCTGGG No data
982131438_982131447 22 Left 982131438 4:152232421-152232443 CCTTCTGCTGCCAATCTATGCAG No data
Right 982131447 4:152232466-152232488 GAGCATTGAGTATGAAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982131447 Original CRISPR GAGCATTGAGTATGAAATCT GGG Intergenic
No off target data available for this crispr