ID: 982134712

View in Genome Browser
Species Human (GRCh38)
Location 4:152263767-152263789
Sequence CTGTGTAATTGGAAAAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982134712_982134714 18 Left 982134712 4:152263767-152263789 CCTTCATTTTTCCAATTACACAG No data
Right 982134714 4:152263808-152263830 CATTCAATAAATGTTTAATCTGG No data
982134712_982134715 26 Left 982134712 4:152263767-152263789 CCTTCATTTTTCCAATTACACAG No data
Right 982134715 4:152263816-152263838 AAATGTTTAATCTGGCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982134712 Original CRISPR CTGTGTAATTGGAAAAATGA AGG (reversed) Intergenic
No off target data available for this crispr