ID: 982139542

View in Genome Browser
Species Human (GRCh38)
Location 4:152304855-152304877
Sequence TCCTCCCTATTCCAAAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982139533_982139542 12 Left 982139533 4:152304820-152304842 CCCTACATCACATCTTCCCACTT No data
Right 982139542 4:152304855-152304877 TCCTCCCTATTCCAAAGACCAGG No data
982139534_982139542 11 Left 982139534 4:152304821-152304843 CCTACATCACATCTTCCCACTTG No data
Right 982139542 4:152304855-152304877 TCCTCCCTATTCCAAAGACCAGG No data
982139538_982139542 -5 Left 982139538 4:152304837-152304859 CCACTTGGGTACCCCATCTCCTC No data
Right 982139542 4:152304855-152304877 TCCTCCCTATTCCAAAGACCAGG No data
982139537_982139542 -4 Left 982139537 4:152304836-152304858 CCCACTTGGGTACCCCATCTCCT No data
Right 982139542 4:152304855-152304877 TCCTCCCTATTCCAAAGACCAGG No data
982139532_982139542 17 Left 982139532 4:152304815-152304837 CCGGGCCCTACATCACATCTTCC No data
Right 982139542 4:152304855-152304877 TCCTCCCTATTCCAAAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982139542 Original CRISPR TCCTCCCTATTCCAAAGACC AGG Intergenic
No off target data available for this crispr