ID: 982144821

View in Genome Browser
Species Human (GRCh38)
Location 4:152374763-152374785
Sequence GGATGAAACCAGTGCCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982144817_982144821 10 Left 982144817 4:152374730-152374752 CCAAAGATAACAGCAATAATTGA 0: 1
1: 0
2: 4
3: 42
4: 464
Right 982144821 4:152374763-152374785 GGATGAAACCAGTGCCAGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 174
982144815_982144821 30 Left 982144815 4:152374710-152374732 CCATATAGTATGCCTAAGGACCA 0: 1
1: 0
2: 0
3: 1
4: 46
Right 982144821 4:152374763-152374785 GGATGAAACCAGTGCCAGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 174
982144816_982144821 18 Left 982144816 4:152374722-152374744 CCTAAGGACCAAAGATAACAGCA 0: 1
1: 0
2: 0
3: 12
4: 248
Right 982144821 4:152374763-152374785 GGATGAAACCAGTGCCAGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982144821 Original CRISPR GGATGAAACCAGTGCCAGAA GGG Intronic
902990981 1:20186679-20186701 GGATGATTCCAGCGTCAGAAGGG - Intronic
903073715 1:20744859-20744881 GCCTGCAACCAGTGCAAGAAAGG - Exonic
905282401 1:36857509-36857531 GGATGAATTCAGTGCCTGACTGG - Intronic
905338014 1:37258584-37258606 GGATGGAACCAGAGCCAGCTGGG - Intergenic
905532881 1:38695952-38695974 GGAAGAAACTAGAGCCAGATAGG - Intergenic
907870865 1:58441583-58441605 TGAGGAAATCAGAGCCAGAAAGG - Intronic
911895316 1:103426270-103426292 AGAGGAAACCAGTGCCTAAAAGG - Intergenic
914395150 1:147259576-147259598 GGAAGAAGCCAGAGACAGAAAGG - Intronic
916156633 1:161856173-161856195 GTATGAAAACAGTTCCATAATGG - Intronic
916438632 1:164799963-164799985 GGGTGAAACTAGAGCCTGAAGGG - Intronic
921554429 1:216580857-216580879 CGCTAAAACCTGTGCCAGAAAGG - Intronic
921904737 1:220484687-220484709 GGAAGAAACCAGGACCAGACAGG + Intergenic
924500387 1:244632474-244632496 GGATGAAAACAATGGCACAAAGG + Intronic
1062847205 10:717361-717383 AGGTGAAAACATTGCCAGAAAGG - Intergenic
1064064910 10:12173544-12173566 GGAGGAAACTGGAGCCAGAAGGG - Intronic
1067431426 10:46248448-46248470 GGATGAAAACAGTGAAAGCATGG + Intergenic
1068906956 10:62337343-62337365 AGTTGAAATCAGTGCCAGCATGG + Intergenic
1069321731 10:67180109-67180131 GGATGAGATCAGAACCAGAAGGG - Intronic
1069349933 10:67513207-67513229 GGATGAAAGGAGTACCAGAATGG - Intronic
1070681451 10:78451998-78452020 GGAGGACACCAGAGCTAGAAGGG - Intergenic
1070691612 10:78531377-78531399 GGACGAAACCTGAGCCAGAGTGG - Intergenic
1072540472 10:96394471-96394493 TGATGGAACCAGGCCCAGAATGG - Intronic
1073178809 10:101571594-101571616 GGATCGAACCAGTCCCAGAGAGG + Intronic
1074868046 10:117556202-117556224 GGATGAGGCCACTGCCAGAGTGG - Intergenic
1075065753 10:119287951-119287973 GGATGAACCCAGGGCCAGCAGGG - Intronic
1075154313 10:119961785-119961807 GGAGGAAATCAAGGCCAGAATGG + Intergenic
1075533554 10:123251075-123251097 GGAAGAACCCAGAGCCAGACAGG + Intergenic
1076488822 10:130842830-130842852 AGATGGAACCAGTCCCAGACTGG + Intergenic
1077192614 11:1261753-1261775 GGGTGAAACCGGCCCCAGAAGGG + Exonic
1078693512 11:13605857-13605879 GGAAGACACAAGTGACAGAATGG - Intergenic
1081279961 11:41197171-41197193 GGATGAATCCACTGCCAAACAGG - Intronic
1082730996 11:56797446-56797468 TGATGACACCACTCCCAGAATGG + Intergenic
1084681125 11:70667055-70667077 GGAGGAAACCATTGCCATCATGG + Intronic
1085705987 11:78787106-78787128 GGAGGACACCAGGGCCAGGATGG + Intronic
1085792574 11:79508593-79508615 GGATAAAGGCAGTGGCAGAAAGG - Intergenic
1086446331 11:86874820-86874842 GGATGATACAAGTGGCCGAAGGG + Intronic
1087077515 11:94139175-94139197 GTATGAAAGCAGTGACAAAATGG - Intronic
1087905599 11:103693212-103693234 GGTTGGAACCATTGCAAGAAAGG + Intergenic
1093439208 12:19173510-19173532 GGACGAAACCAGTGCTAGCTGGG + Intronic
1094593697 12:31844767-31844789 GTATGACTCCAGTGCCAGATTGG - Intergenic
1095237856 12:39820352-39820374 GTTTGAAAACAGTGCCAAAATGG - Intronic
1098598578 12:72302155-72302177 GGAAGAAACCAGAGAGAGAAAGG + Intronic
1100525022 12:95410944-95410966 GGAAGGAACTAGAGCCAGAAGGG + Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1110160170 13:72367411-72367433 GGGTGAAACCAGGGGCAGAGAGG - Intergenic
1117745740 14:58867589-58867611 GGATAAAACCAGAAGCAGAAAGG - Intergenic
1119463098 14:74828135-74828157 CAATGAAAGCAGTGGCAGAAAGG - Intronic
1122541386 14:102499583-102499605 GGTTGAAACCAGTGCCTCTATGG + Exonic
1124902332 15:33835922-33835944 TGATGAAACCAAAACCAGAAAGG - Intronic
1129721035 15:77878149-77878171 GGATGAAAGCTGTGCCAGGCTGG - Intergenic
1130661591 15:85835105-85835127 GGTGGAAACCAGAACCAGAAAGG - Intergenic
1132922381 16:2404439-2404461 GGATTAACCCAGTGTAAGAAGGG + Intergenic
1137402093 16:48162232-48162254 AGAGGAAACCAGAGCCAGAGTGG + Intergenic
1139845910 16:69921211-69921233 GGAGAAAACCAATGCCAGAGGGG - Intronic
1142508319 17:379986-380008 GGAAGAAACCAGAGCCAGCCCGG + Intronic
1143576077 17:7794147-7794169 GGAGGAAAACAGTGCGAGGAGGG - Intronic
1144307066 17:13978328-13978350 AGGCGAGACCAGTGCCAGAAGGG - Intergenic
1144424040 17:15124403-15124425 GGAAGAAACCACTTCCTGAATGG + Intergenic
1146064112 17:29622029-29622051 GGATGAAAACAGTAGCAGAAAGG - Intronic
1146437083 17:32860166-32860188 GGATGAAACCAGCACAAGAAGGG + Intronic
1148756174 17:49974026-49974048 GGAGGAAACCAGCTCCAGATGGG + Exonic
1148787751 17:50153717-50153739 GGATGAAAGAAGGCCCAGAAAGG + Intergenic
1148989595 17:51653988-51654010 GGATGGAGCCAGAGCCAGATGGG - Intronic
1149645587 17:58239086-58239108 GGGGGAAAACAGTGACAGAATGG + Intronic
1150640433 17:66946081-66946103 AGATGAATCCAGTGCCAGCATGG - Intergenic
1152334933 17:79695406-79695428 GGATGACACAAGTGCTTGAAAGG - Intergenic
1154142000 18:11832436-11832458 GGATCAAATCAGTGCCAAAGAGG - Intronic
1154257063 18:12791849-12791871 TGAGGAAGCCAGTGCCAGAGAGG - Intronic
1156421569 18:36959678-36959700 GTATGAAAGCACAGCCAGAAGGG + Intronic
1158146677 18:54322455-54322477 GGATGTCAGCAGGGCCAGAAGGG - Intergenic
1158270837 18:55714391-55714413 GGATGAAAACAGGCCCAGTAAGG - Intergenic
1159031126 18:63233432-63233454 CTATTAAACCAGTGCCAGAAAGG - Intronic
1159152561 18:64538724-64538746 GTCTAAAACCACTGCCAGAATGG - Intergenic
1159221174 18:65464892-65464914 GGAGTCAACCAGTGCCAGCAAGG - Intergenic
1160293421 18:77616445-77616467 GCATGAAACGAGAGCAAGAATGG + Intergenic
1166279816 19:41784359-41784381 GGATGAAATAAGTTACAGAAGGG + Intergenic
1167959421 19:53094456-53094478 GGATGAAACCACTGCCCCACAGG + Intronic
925196650 2:1931244-1931266 GATTGATACCAGTGCCAGAGAGG + Intronic
925412706 2:3649132-3649154 TAATGAAACCAGTTCCACAATGG + Intergenic
925805950 2:7648140-7648162 TGATGTCACCAGTGCTAGAAAGG + Intergenic
928279316 2:29930167-29930189 GAGTGAAATCAGTGTCAGAAGGG + Intergenic
928824700 2:35405887-35405909 GAATGGAATCAGTACCAGAAGGG + Intergenic
930840400 2:55839033-55839055 ATATGAAAGCAGTGCCAAAATGG + Intergenic
932042332 2:68313828-68313850 GGATAAATCCAGTGGCAAAAAGG + Intronic
932466850 2:71929558-71929580 GGATCAAACAAGTCCCAGAGAGG - Intergenic
933453754 2:82494874-82494896 GGATGAAAGCACTGCCAAACGGG - Intergenic
934706150 2:96483015-96483037 GGATGAAACGAGAGCTTGAATGG + Intergenic
940864925 2:158808270-158808292 TGATGAAGCCAGTGCCAAATGGG - Intronic
941289205 2:163654160-163654182 GAATGAAATCAGTGATAGAAAGG - Intronic
942382160 2:175403329-175403351 GGATCAGCTCAGTGCCAGAATGG + Intergenic
943235003 2:185306577-185306599 GGATGAAGTAAGTGCCAGAAGGG + Intergenic
945282692 2:208050815-208050837 GGATGAAACCATTACCTGAGGGG + Intergenic
946389624 2:219407700-219407722 GGATAAACCCAGACCCAGAACGG + Intergenic
948939739 2:241189842-241189864 GGAAGAAACCAGTGCCGGGGCGG - Intronic
1169650847 20:7865531-7865553 GGAGGAAACCAGACACAGAATGG - Intergenic
1172084057 20:32364867-32364889 GGATGACAACAGAGTCAGAATGG + Intronic
1172809945 20:37640342-37640364 GGTTGCAATCAGTCCCAGAAAGG + Intergenic
1173299661 20:41790608-41790630 GGATGAAACCAATGCCATGGTGG + Intergenic
1174140448 20:48409592-48409614 GGAGGAAACTAGAGCCAGAGAGG - Intergenic
1174981341 20:55398838-55398860 GGATGCAAGCAGTGACACAATGG + Intergenic
1176883627 21:14228676-14228698 GGATGAAGTGAGTGCCAGCAGGG - Intergenic
949093697 3:60775-60797 AGTTGAAATCAGTGTCAGAAGGG - Intergenic
951406701 3:22309030-22309052 GTATGAAAATACTGCCAGAAAGG + Intronic
955043160 3:55336154-55336176 TGATGAAGCCAGTGGCACAAAGG - Intergenic
956226540 3:66965305-66965327 TGATAAAAGCAGTGACAGAAAGG - Intergenic
957690464 3:83559279-83559301 AAATGAAACCAGTGAAAGAAAGG + Intergenic
958119991 3:89273796-89273818 GCATGCAACTACTGCCAGAAAGG + Intronic
960185914 3:114638694-114638716 GGATGAAACCAGGTCAAAAAAGG + Intronic
962855170 3:139338821-139338843 GCAGGAAGCCAGAGCCAGAAAGG - Intronic
966744345 3:183261707-183261729 GGAAAAAACCAGAGCTAGAATGG + Intronic
969623667 4:8291662-8291684 GGATGTGTCGAGTGCCAGAATGG - Intronic
972946087 4:44257456-44257478 GCATGAAAACAGTGCCCTAAGGG - Intronic
973893885 4:55393778-55393800 GGCTGAAGACAGAGCCAGAAGGG - Intergenic
974064767 4:57067431-57067453 GAAAGAAGCCAGTCCCAGAAGGG + Intronic
977372730 4:96160726-96160748 GAATGAAATAAGTTCCAGAAAGG + Intergenic
977668872 4:99672315-99672337 AGATGAAACCTGTGACAGACTGG + Intergenic
982144821 4:152374763-152374785 GGATGAAACCAGTGCCAGAAGGG + Intronic
982261033 4:153494643-153494665 GGATGAAAACTTTGGCAGAAGGG - Intronic
983170644 4:164531937-164531959 GGATGAGACCAGAGAAAGAACGG - Intergenic
983561783 4:169108882-169108904 GGATGAAACCAGTGGAAGGAAGG + Intronic
985682215 5:1262051-1262073 GGATGAAACCAGTGAGGCAACGG - Intronic
986659344 5:10045106-10045128 GGATGAATCCAGTGCCACCCAGG - Intergenic
987784803 5:22486157-22486179 TCATGAAGCCAGTGCCAGCAAGG - Intronic
996653745 5:125914237-125914259 GGGGGAAACAATTGCCAGAAGGG + Intergenic
997782976 5:136678374-136678396 GGAGGACACCAGTGCCACACAGG - Intergenic
997979129 5:138458346-138458368 GGGTGAAGCCGGTGCCAGAGTGG + Intergenic
998204727 5:140150310-140150332 GGATGAATGCAGGGCCAGGAAGG - Intergenic
998720741 5:144945606-144945628 GGAGGAAAATAGTGACAGAAGGG - Intergenic
1000680097 5:164172779-164172801 GGCTGAAAACAGTGAAAGAAAGG - Intergenic
1001012678 5:168112684-168112706 TGAGCAAACCAGTGTCAGAAAGG - Intronic
1001380120 5:171300368-171300390 TAAAGAAAACAGTGCCAGAATGG - Intergenic
1001759554 5:174195814-174195836 GAATTAAACCAATGCCAGCATGG - Intronic
1002047443 5:176549876-176549898 GGATGAGAAGAGTTCCAGAAAGG + Intronic
1002805213 6:567181-567203 GGATGAAGCCACTGCCAGCTGGG + Intronic
1007815916 6:44525497-44525519 GGAAGCAAGCAGAGCCAGAAAGG - Intergenic
1008079514 6:47179559-47179581 GGATGAATCCAGGGACACAATGG + Intergenic
1008517717 6:52333958-52333980 GGATGAAAACACTGTGAGAAAGG + Intergenic
1008782618 6:55126219-55126241 GGGAGAAACCAGTGCAAAAAAGG - Intronic
1012665600 6:101964600-101964622 GGATCAAACAAGAGCCACAAGGG - Intronic
1014255896 6:119159820-119159842 GGGAGAAACCACAGCCAGAATGG + Intergenic
1015728556 6:136324615-136324637 GGAAGAAAGTAGTGCCAGACTGG + Intergenic
1016913692 6:149224703-149224725 GGAAGAAACCAGTCCTAAAATGG + Intronic
1018177673 6:161191563-161191585 GGGTGAAACTAGAGCCAGACAGG + Intronic
1023098395 7:36687203-36687225 GGAGGAAACCAGGTTCAGAAAGG - Intronic
1023637564 7:42227978-42228000 GGAGGAAACCAGAACCTGAAGGG - Intronic
1026019159 7:66694668-66694690 GGGTGAAGCCAGTGGCAGTAGGG + Intronic
1026497736 7:70918494-70918516 CGATGGCACCAGTGACAGAATGG + Intergenic
1026777820 7:73242087-73242109 GGAAAAACCCAGAGCCAGAAAGG - Intergenic
1026881220 7:73907977-73907999 GGATGAAGGCAGTGGCAGTAGGG - Intergenic
1027018672 7:74795480-74795502 GGAAAAACCCAGAGCCAGAAAGG - Intergenic
1027069357 7:75150459-75150481 GGAAAAACCCAGAGCCAGAAAGG + Intergenic
1027548853 7:79565182-79565204 GGATGCAACCAATGCCTGAGAGG + Intergenic
1028090642 7:86696469-86696491 GGCTAAAACCAGTGTCAGCAGGG - Intronic
1028489897 7:91399617-91399639 TGATAAAAGCAGAGCCAGAATGG - Intergenic
1028656868 7:93218683-93218705 GGATGAGACTTGTGCAAGAATGG - Intronic
1028909482 7:96192109-96192131 AGATTAACACAGTGCCAGAATGG + Intronic
1029578572 7:101420148-101420170 GGACAAAACCAGTCCCAGGATGG + Intronic
1032122646 7:129168322-129168344 GCATGATACCAGCTCCAGAAGGG + Exonic
1032958150 7:136997916-136997938 GGATGAAATCACTGCCACAGAGG + Intronic
1037477942 8:19276031-19276053 AGATTAAACCAGTGTCTGAATGG - Intergenic
1038451734 8:27643829-27643851 GGAAGAATGCAGTCCCAGAAAGG + Intronic
1039919397 8:41882685-41882707 GCATGAAACCAGGGTCAGACAGG - Intronic
1040900256 8:52410822-52410844 GGAGGAGACCAGGGCAAGAAGGG + Intronic
1044136344 8:88591063-88591085 GGACAAACCCAGTGCCAGTATGG + Intergenic
1044942725 8:97359927-97359949 GGCTGAAACCAGAGTCAGCAGGG - Intergenic
1045226369 8:100249985-100250007 GGTTGAAACCAGTGCAATAAGGG + Intronic
1045260067 8:100564931-100564953 TTAGGAAACCAGGGCCAGAAAGG - Intergenic
1045430701 8:102112362-102112384 GGATTAATCCAGCTCCAGAAGGG + Intronic
1045682204 8:104674376-104674398 GGAAGACACAAGTGCCAGTAAGG - Intronic
1053141058 9:35682984-35683006 GGATGAAGCCAGTGCCAGAGTGG + Intronic
1056494747 9:87145288-87145310 AGATCAAACCAATGCAAGAAGGG - Intergenic
1057920521 9:99093182-99093204 GGAACAAACGAGAGCCAGAAGGG - Intergenic
1058013579 9:100004531-100004553 GGTAAAACCCAGTGCCAGAAAGG - Intronic
1059126703 9:111695046-111695068 GGAGGAAAACAGTGTCAGACAGG - Intronic
1059757691 9:117309255-117309277 AGATGCAGCCAGTGGCAGAAGGG - Intronic
1061662322 9:132138448-132138470 GGATGATAACAGTGCCTGATTGG + Intergenic
1062463137 9:136670173-136670195 GGATGAATGCAGTGCTAGGAGGG + Exonic
1062629093 9:137455633-137455655 TGCTGAAGCCAGGGCCAGAAGGG + Exonic
1187114809 X:16338317-16338339 GGAGGAAACCAGTTCCATGAAGG - Intergenic
1188284806 X:28314515-28314537 GGATGCAACCCCTTCCAGAATGG - Intergenic
1189746950 X:44178732-44178754 GGAAGGCACCAATGCCAGAATGG + Intronic
1193674001 X:84424936-84424958 GGAGGAAACCAATGCAAAAATGG + Intronic
1194787652 X:98106436-98106458 GGACAAACCCTGTGCCAGAAGGG - Intergenic
1195613847 X:106897243-106897265 GGAGGAAATCAGTGCTAGGATGG + Intronic
1198030199 X:132747239-132747261 GGACAAAACCTGTGCCACAAGGG + Intronic