ID: 982145464

View in Genome Browser
Species Human (GRCh38)
Location 4:152384496-152384518
Sequence GAATCATGGTTGTCTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 341}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982145462_982145464 27 Left 982145462 4:152384446-152384468 CCACTTATATAAGGTACTTGGAA 0: 1
1: 2
2: 40
3: 243
4: 926
Right 982145464 4:152384496-152384518 GAATCATGGTTGTCTGAGACAGG 0: 1
1: 0
2: 0
3: 41
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982145464 Original CRISPR GAATCATGGTTGTCTGAGAC AGG Intronic
900024383 1:207322-207344 GAGTCATGGGTGGCTGAGATGGG + Intergenic
902249338 1:15143467-15143489 GAATGATGGTTACCAGAGACTGG + Intergenic
903341483 1:22657561-22657583 GATTCATGGTTGTCAGGGGCTGG + Intronic
903468961 1:23571960-23571982 GATTAATGGTTGCCTGGGACTGG + Intergenic
905092621 1:35441474-35441496 TAATGGTGGTTGTCTTAGACTGG + Intronic
905534729 1:38712330-38712352 GAATGATGGTTGTGGTAGACAGG - Intergenic
905739343 1:40355994-40356016 GAATAATGGTTACCAGAGACAGG - Intronic
905950152 1:41944092-41944114 GAATGATGGTTGCCAGGGACTGG + Intronic
909216368 1:72895630-72895652 GAATGATGGTTACCAGAGACTGG + Intergenic
909230854 1:73087774-73087796 GAATGATGGTTATCAGAGACAGG - Intergenic
910226058 1:84937515-84937537 GTATTATAGTTGTCTGGGACTGG - Intronic
910556457 1:88539723-88539745 GAAACTGGGTTGTCTGAGAAAGG + Intergenic
911240877 1:95464553-95464575 GAATGATGGTTATCAGAGGCCGG - Intergenic
914265990 1:146038836-146038858 GAACTATTGTTGTTTGAGACAGG - Intergenic
914737497 1:150431932-150431954 GAATCATGGTTGCTGGAGAAAGG + Intronic
918199360 1:182252875-182252897 GAATCATGGTTACCGGAGGCTGG + Intergenic
918401521 1:184167513-184167535 GAATGATGGTTGCCAGAGGCTGG - Intergenic
918962801 1:191302621-191302643 TAATCATGGCTGCCTGGGACTGG + Intergenic
922911262 1:229219711-229219733 GAATGGTGGTTGTCAGGGACTGG + Intergenic
923494442 1:234512077-234512099 GAATGGTGGTTATCTGAGGCTGG - Intergenic
923835011 1:237601405-237601427 GAATAGTGGTTATCAGAGACTGG + Intronic
1063701726 10:8391115-8391137 GAATGGTGGTTGTCAGAGGCTGG - Intergenic
1063770460 10:9192893-9192915 GAATCATGGTTGCCAGGGACGGG + Intergenic
1063774905 10:9251890-9251912 GAATGATGGTTATCAGAGGCTGG + Intergenic
1063864451 10:10348861-10348883 GAATGATGGTTGTCAGAGTAAGG - Intergenic
1065433426 10:25682627-25682649 GAATGATGGTTGTCAGTGTCTGG + Intergenic
1066572785 10:36791476-36791498 GAATAATGGTTTTCAGAGACTGG + Intergenic
1066652866 10:37675496-37675518 GATTCATGGTTGGCTGGAACCGG - Intergenic
1067334952 10:45353539-45353561 GAATGATGGTTATCAGAGACTGG + Intergenic
1067829081 10:49599700-49599722 GACTCATGGCTGTCTGAGTAGGG - Intergenic
1068392165 10:56412227-56412249 GAATGATGGTTATCAGAGACTGG - Intergenic
1068508382 10:57931797-57931819 GAATCATGGTTAGCACAGACTGG + Intergenic
1068840140 10:61603507-61603529 GAATGATGGTTATCAGAGGCTGG - Intergenic
1071691326 10:87822611-87822633 GAATGATGGTTATCAGAGGCTGG + Intronic
1071706739 10:88007547-88007569 GAATGATGCTTATCAGAGACTGG + Intergenic
1072525826 10:96270675-96270697 GCATCATGGCTTTCAGAGACTGG - Intronic
1072843779 10:98805114-98805136 GAAGGATGGTTGTCAGAGGCTGG + Intronic
1072865864 10:99060922-99060944 GAATGATGGTTATCAGAGGCTGG + Intronic
1073316753 10:102586873-102586895 GAATGGTGGTTGTCAGAGGCTGG - Intronic
1073830137 10:107374380-107374402 CAAACATGGTTGTCAAAGACAGG + Intergenic
1074202820 10:111254570-111254592 GAATGATGGTTGCCAGAGGCTGG + Intergenic
1074619426 10:115103704-115103726 GAATGATGGTTACCTGAGGCTGG - Intronic
1075554988 10:123424133-123424155 GAATGATGGTTACCTGAGGCTGG + Intergenic
1076173623 10:128345636-128345658 GAATCATGGTTATGAGAGGCTGG + Intergenic
1079449534 11:20587728-20587750 GCATGTTGGTTGACTGAGACAGG - Intergenic
1079772843 11:24485332-24485354 GAAGGATGGTTATCAGAGACTGG - Intergenic
1080316116 11:30950681-30950703 GAATGATGGTTGCCAGAGCCTGG + Intronic
1081187086 11:40057011-40057033 GAATGATGGTTACCAGAGACTGG + Intergenic
1081192765 11:40124635-40124657 GAATGATGGTTATCAGAGACTGG + Intronic
1081212150 11:40349227-40349249 GAATGATGGTTATCAGAGTCTGG - Intronic
1081366085 11:42237113-42237135 GAATAGTGGTTGTCAGAGACTGG - Intergenic
1081369505 11:42282831-42282853 GAATGGTGGTTGTCAGAGAGTGG + Intergenic
1081442409 11:43094685-43094707 GAATCGTGGTTGCCAGAGGCTGG + Intergenic
1081711467 11:45219316-45219338 GAATCTCTGTTTTCTGAGACTGG - Intronic
1082743024 11:56931840-56931862 GAATGATGGTTGCCAGGGACTGG - Intergenic
1085466171 11:76724862-76724884 GAATGATGGTTACCAGAGACTGG - Intergenic
1085952638 11:81350957-81350979 GAATGGTGGTTGTCAGGGACTGG - Intergenic
1086449808 11:86904799-86904821 GAATCTTGGGAGTCTGAGGCAGG + Intronic
1086962674 11:92995727-92995749 GAATGTTGGTTGTCAGGGACTGG + Intergenic
1087047674 11:93856797-93856819 GAATCCTGGAAATCTGAGACAGG + Intergenic
1087451937 11:98334723-98334745 GAATGATGGTTGCCAGGGACTGG - Intergenic
1087467789 11:98531214-98531236 GAATCCTGAATATCTGAGACAGG + Intergenic
1087739579 11:101871898-101871920 GAATCGTGGTTATCAGAGGCTGG + Intronic
1088150148 11:106735305-106735327 GAATGATGGTTACCAGAGACTGG - Intronic
1089734919 11:120543954-120543976 GAATGATGGTTGTCAGGGGCTGG + Intronic
1089904445 11:122024016-122024038 GAAAGATGGTTGCCAGAGACTGG + Intergenic
1090939879 11:131377895-131377917 GAATCATGGGTTTATGAGAAAGG - Intronic
1091378080 12:38857-38879 GAGTCATGGGTGGCTGAGATGGG + Intergenic
1093259002 12:16911225-16911247 GAATGATGGTTATCAGAGGCTGG - Intergenic
1095860043 12:46906483-46906505 GAATGATGGTTACCAGAGACTGG - Intergenic
1096564361 12:52465205-52465227 GAATGATGGTTATCAGAGACTGG + Intergenic
1097822068 12:64138132-64138154 GAATGGTGGTTGTCAGGGACTGG - Intronic
1098682501 12:73374319-73374341 GAATGATGGTTGCTAGAGACTGG - Intergenic
1099652737 12:85449197-85449219 GAATGATGGTTACCAGAGACTGG - Intergenic
1099669736 12:85674571-85674593 GAATGATAGTTGCCAGAGACTGG + Intergenic
1099782104 12:87209332-87209354 GAATGACAGTTGTCAGAGACTGG + Intergenic
1101811204 12:108109443-108109465 GAATGATGGTTGTCAGGGGCTGG - Intergenic
1101831197 12:108257973-108257995 AAATCAGGTTTGTCTGACACTGG - Intergenic
1103142566 12:118562280-118562302 GATTCATGGTTGTCAGGGCCTGG - Intergenic
1103393793 12:120592451-120592473 GATTCATGGTTGTCAGCGGCTGG - Intergenic
1104114898 12:125740113-125740135 GAACAATGGTTTTCAGAGACTGG + Intergenic
1104233277 12:126906333-126906355 GAAACATGCTTGTCTGAGAGCGG - Intergenic
1104435618 12:128754135-128754157 GATTCATGGTTTTCAGGGACTGG + Intergenic
1105313816 13:19237874-19237896 GAATGATGGTTATCAGAGGCTGG + Intergenic
1105429320 13:20322926-20322948 GAATCATGGTTGCCAGGGGCTGG + Intergenic
1106742902 13:32665970-32665992 GAATGGTGGTTATCAGAGACTGG + Intronic
1106832209 13:33596703-33596725 GAATTATGGTTATCAGAGAAAGG - Intergenic
1107545788 13:41432428-41432450 GAATCTAGTTTCTCTGAGACAGG - Intergenic
1107553813 13:41500230-41500252 GATTCGTGGTTGTCTGGGGCTGG - Intergenic
1107686874 13:42909749-42909771 GAATCATGGTTACCAGAGGCTGG + Intronic
1107734127 13:43378123-43378145 GAAACATGGTTTTCAGATACTGG + Intronic
1108880594 13:55109437-55109459 GAATGATGGTTATCAGAGGCTGG + Intergenic
1109098711 13:58150919-58150941 AAATTATGGTTGCCTGAAACAGG - Intergenic
1110090592 13:71442200-71442222 GAATGATGGTTGCCAGAGACTGG - Intronic
1110528349 13:76566618-76566640 GAATAATGGTTGTCAGGGGCTGG + Intergenic
1111447018 13:88359822-88359844 GAATGATGGTTGACGGAGGCTGG + Intergenic
1111502563 13:89140811-89140833 GAATGATGGTTATCAGAGGCTGG - Intergenic
1111539524 13:89652463-89652485 GAATGGTGGTTGCCAGAGACTGG + Intergenic
1114206278 14:20574268-20574290 GAATGATGGTTACCAGAGACTGG + Intergenic
1114360273 14:21964389-21964411 GAATGATGGTTATCAGAGACTGG - Intergenic
1114929207 14:27446855-27446877 GAATGATGGTTGTCTGGGGCTGG - Intergenic
1115673530 14:35643864-35643886 GAATGATGGTTACCAGAGACTGG + Intronic
1115984443 14:39089429-39089451 GAATCATGTTTCCATGAGACAGG - Intronic
1117313664 14:54553501-54553523 GAATGATGGTTGTCAGGGGCTGG + Intergenic
1119014959 14:71040843-71040865 GAAGCATGGTTATCAGCGACCGG - Intronic
1119037030 14:71239158-71239180 GAATCATGGCTGCCAGGGACTGG + Intergenic
1119718618 14:76876131-76876153 GAATCAGGGTTGTTAGACACAGG - Intergenic
1121055038 14:90845451-90845473 GATTCATGGTTGTCTAGGACTGG - Intergenic
1121365816 14:93308820-93308842 GAATGATGGTTGTCAGGGGCTGG + Intronic
1122489543 14:102104758-102104780 GAATGATGGTTATCAGAGGCTGG - Intronic
1123462521 15:20486138-20486160 GAATGATGGTTATCAGAGACTGG - Intergenic
1123655540 15:22514264-22514286 GAATGATGGTTATCAGAGACTGG + Intergenic
1124273208 15:28302158-28302180 GAATGATGGTTATCAGAGACTGG - Intronic
1124309447 15:28609459-28609481 GAATGATGGTTATCAGAGACTGG + Intergenic
1124450984 15:29790700-29790722 GAATGATGGTTACCAGAGACCGG - Intronic
1124863372 15:33464904-33464926 GAATGGTGGTTGTCAGAGACAGG - Intronic
1125028598 15:35054571-35054593 GAGTCATGGTTGTCTGTAAATGG + Intergenic
1126052437 15:44698404-44698426 GAATAATGGTTATCAGAGGCTGG - Intronic
1126581578 15:50247071-50247093 GAATGATGGTTGGCAGAGGCTGG + Intronic
1126862347 15:52897932-52897954 GAATGATGGTTACCAGAGACTGG - Intergenic
1126953164 15:53905594-53905616 GAATGGTGGTTGTCAGAGACTGG + Intergenic
1126968278 15:54081455-54081477 GAATCTTGGTACTCTGATACTGG + Intronic
1126979191 15:54222259-54222281 GAATGATGGTTATCAGAGGCTGG - Intronic
1127069676 15:55276628-55276650 GAATGATGGTTGCCAGGGACTGG + Intronic
1127177389 15:56374713-56374735 GAAGAATGGTTATCAGAGACTGG - Intronic
1128715788 15:69906980-69907002 GATTAATGGTTGCCTGAGGCTGG + Intergenic
1128745153 15:70108947-70108969 GAATGATGGTTGTCAGGGGCGGG + Intergenic
1130421783 15:83755432-83755454 GAATGGTGGTTGTCAGGGACTGG - Intronic
1132241148 15:100257927-100257949 GAATGGTGGTTGTCAGAGGCTGG - Intronic
1133203354 16:4218118-4218140 GAATCAGGGCTGACTGAGGCTGG - Intronic
1134239901 16:12497939-12497961 GAATCAACCTTGTCTGAGAGTGG - Intronic
1135288079 16:21211202-21211224 GAATGGAGGTTGTCTGAGCCAGG + Intronic
1138006094 16:53339223-53339245 GATTAGTGGTTGTCTAAGACTGG + Intergenic
1140843893 16:78868350-78868372 GAATGATGGTTGCCTGGGGCTGG + Intronic
1140980832 16:80107538-80107560 GAATGGTGGTTATCAGAGACTGG + Intergenic
1140988438 16:80183561-80183583 GAATGATGGTTGCCTGGGACTGG + Intergenic
1141600835 16:85125313-85125335 GATGCATGGTTGCCTGAGGCTGG + Intergenic
1143824884 17:9597081-9597103 GAATGGTGGTTATCAGAGACTGG - Intronic
1143838683 17:9713432-9713454 GAATGATGGTTGCCAGAGGCCGG - Intronic
1143916770 17:10299613-10299635 GAATAATGGTTGCCAGAGGCTGG - Intronic
1144350702 17:14393265-14393287 GAATAGTGGTTGTCAGAGAATGG + Intergenic
1146076000 17:29729863-29729885 GAATGATGGTTACCAGAGACTGG + Intronic
1146216795 17:30982932-30982954 GAATGATGGTTGCCAGAGGCTGG - Intronic
1146302675 17:31702268-31702290 GAATGATGGTTATCAGAGGCTGG - Intergenic
1147475392 17:40706891-40706913 GAATGATGGTTATCAGAGGCTGG - Intergenic
1148317605 17:46717317-46717339 GAATGATGGTTATCAGAGGCTGG + Intronic
1148585980 17:48780664-48780686 GAATCATGGTTGCCAGGGACTGG - Intronic
1153067710 18:1065271-1065293 GAATTATGGATTCCTGAGACAGG - Intergenic
1153266471 18:3275294-3275316 GAAGGATGGTTATCAGAGACTGG + Intronic
1153363808 18:4230610-4230632 GAATGATGGTTGTCAGATGCTGG + Intronic
1154089016 18:11339492-11339514 GAATGGTGGTTGTCAGGGACTGG + Intergenic
1155315972 18:24570320-24570342 GACTCATGGTTGCCTGGGGCTGG - Intergenic
1155417148 18:25611403-25611425 GAATGGTGGTTGCCTGAGGCTGG + Intergenic
1155767924 18:29659113-29659135 GAATGATGGTTATCAGAGGCTGG + Intergenic
1158749049 18:60237461-60237483 GAATGATGGTTGCCGAAGACTGG - Intergenic
1158887645 18:61843780-61843802 GAATCATGGTTGCCAGGGAATGG + Intronic
1159620147 18:70627980-70628002 CAAGCATGGTTATCTGACACAGG - Intergenic
1159895694 18:73993897-73993919 GAATGATGGTTATCAGAGGCTGG - Intergenic
1161152792 19:2718346-2718368 GACCCATGGTTGTTGGAGACGGG - Intronic
1161964091 19:7538709-7538731 GTCTCAAGGTTCTCTGAGACTGG + Intronic
1162270403 19:9610029-9610051 ACATCATGGTTGCCTGAGTCTGG - Exonic
1162280162 19:9689967-9689989 ACATCATGGTTGCCTGAGTCTGG - Exonic
1165548847 19:36565983-36566005 GAATTTTGTTTGTTTGAGACAGG + Intronic
1166169916 19:41020628-41020650 GAATGATGGTTACCAGAGACTGG - Intergenic
1166276872 19:41760180-41760202 GAATCATGGTTGCCAGGGATTGG - Intronic
1168389975 19:55999112-55999134 GAATGGTGGTTGCCAGAGACTGG - Intergenic
928776391 2:34769104-34769126 GAATGATGGTTGCCAGAGGCTGG - Intergenic
930146112 2:48006263-48006285 GAACCCTGGTTGGCTGAGGCAGG + Intergenic
930496609 2:52153115-52153137 GAATTATGGTTTCCTGAGGCTGG + Intergenic
933175887 2:79172628-79172650 GAATGATGGTTGCCAGAGACTGG + Intergenic
933581247 2:84129423-84129445 GAATTCTGTTTGGCTGAGACAGG - Intergenic
933806566 2:86002649-86002671 GAATCAGGGTGGTCAGAGCCAGG + Intergenic
935018091 2:99203102-99203124 GAATAATGGTTACCAGAGACTGG - Intronic
935461313 2:103338335-103338357 GAATGATGGTTGCCAGAGGCTGG + Intergenic
938863703 2:135396643-135396665 GAATGATGGTTATTAGAGACTGG + Intronic
939987187 2:148841281-148841303 GAATCATGGTTGCCAGGTACTGG - Intergenic
940226165 2:151403250-151403272 GAGTGGTGGTTATCTGAGACTGG - Intergenic
940801864 2:158141936-158141958 GAATCCTGGTTGGCTGAATCTGG + Intergenic
940875781 2:158895826-158895848 GAATGGTGGTTGTCAGGGACTGG - Intergenic
941430522 2:165408763-165408785 GAATGAAGGTTGTCTTAGATTGG + Intergenic
942772656 2:179540672-179540694 GTATGATGGGTGTCTGACACAGG - Intronic
944697798 2:202218456-202218478 GAATCATGGTTGTCACTGGCTGG + Intronic
945359197 2:208876184-208876206 GAATGATGGTTATCAGAGGCTGG - Intergenic
945652045 2:212574837-212574859 GAATGATGGTTATCTGAGGCTGG - Intergenic
945713916 2:213334783-213334805 GAAGGATGGTTGCCAGAGACTGG + Intronic
945939617 2:215934964-215934986 GAAGAATGGTTATCAGAGACTGG - Intergenic
946518408 2:220438930-220438952 GAATGATGGTTGGCAGAGGCTGG - Intergenic
946605952 2:221404903-221404925 GAATGATGGTTACCAGAGACTGG - Intergenic
947997507 2:234541153-234541175 GAATGGTGGTTGTCAGAGGCTGG + Intergenic
948490951 2:238312951-238312973 GAATGGTGGTTGTCAGGGACTGG + Intergenic
1168856364 20:1012010-1012032 GAATCCAGGTTGTCTGACTCAGG - Intergenic
1169821301 20:9713827-9713849 GAATAATGGTTTCCAGAGACTGG + Intronic
1169921073 20:10734790-10734812 GGAGCATGGTTGCCTGAGGCAGG + Intergenic
1170611858 20:17920727-17920749 TAATAATAGTTTTCTGAGACAGG - Intergenic
1172773573 20:37395136-37395158 AAATCATGGTTGCCTAAGGCAGG + Intronic
1173397351 20:42691766-42691788 GAATCATGGCTTTTGGAGACAGG - Intronic
1173442121 20:43087077-43087099 GATTCATGGTTGCCAGGGACTGG - Intronic
1174791835 20:53486065-53486087 GAATGATGGTTGCCAGGGACTGG - Intronic
1174909241 20:54588591-54588613 GAATCAGGTTTGTCTCAGGCAGG + Exonic
1174950795 20:55039727-55039749 GAATCGTGGTTGCCAGGGACTGG - Intergenic
1174952348 20:55056063-55056085 GAATAATGGTTGGCTGGGCCTGG + Intergenic
1175249608 20:57601255-57601277 GAATCATGGGAGTGTGGGACAGG - Intergenic
1176154248 20:63610045-63610067 GCATGAGGGTTGTCTGAAACAGG + Intronic
1177246486 21:18531797-18531819 GAATAATGGTTGACAGAGGCTGG + Intergenic
1177256708 21:18672555-18672577 GAATGATGGTTATCAGAGGCTGG + Intergenic
1177850105 21:26335459-26335481 GAATCATGGTTAACAGAGACTGG - Intergenic
1178123991 21:29497972-29497994 GAATGATGGTTACCAGAGACTGG - Intronic
1179263680 21:39782528-39782550 GAATCGTGGTTGCCAGGGACTGG - Intronic
1179327228 21:40359765-40359787 GATTAGTGGTTGTCTGGGACTGG + Intronic
1180237054 21:46468516-46468538 GAATGGTGGTTGCCAGAGACTGG + Intronic
1182009806 22:26991026-26991048 GAATGGTGGTTGTCAGAAACTGG - Intergenic
1182203379 22:28597350-28597372 GAATGGTGGTTGCCAGAGACTGG - Intronic
1183234575 22:36607763-36607785 GAATCCTGGTTCTATGTGACAGG - Intronic
952180861 3:30915015-30915037 GAATGATGGTTATCGGAGGCTGG + Intergenic
953207016 3:40840106-40840128 GAATGATGGTTGTCAGGGGCTGG + Intergenic
955656778 3:61252264-61252286 GAACCATGGTGGTCAGAAACGGG - Intergenic
955913858 3:63886223-63886245 GAATAATGGTTGCCAGAGGCTGG + Intronic
957720542 3:83992082-83992104 GAATGATGGTTACCTGAGGCTGG - Intergenic
957755117 3:84475268-84475290 GAATGATGGTTAGCAGAGACTGG + Intergenic
958100624 3:89004707-89004729 GAGTCATGGTTGCCTAAGGCTGG + Intergenic
959123474 3:102261809-102261831 AAAATATGGTTTTCTGAGACAGG - Intronic
959250482 3:103935909-103935931 GAATAATGGTTATCAGAGTCTGG - Intergenic
959307150 3:104682199-104682221 GAAGGATGGTTATCAGAGACTGG + Intergenic
961041067 3:123678687-123678709 GAATCAGAGGTGTCTGGGACTGG + Intronic
961118126 3:124349293-124349315 GAATGGTGGTTGTCAGAGGCTGG + Intronic
963223272 3:142834068-142834090 GACTGATGGTTCTCTGTGACGGG + Intronic
964874872 3:161355656-161355678 AAATGATGGTTGTCAGGGACTGG + Intronic
965005066 3:163010739-163010761 GAATCATGGTTGCCAGAGGCTGG + Intergenic
966361554 3:179135595-179135617 GAATGATGGTTACCAGAGACTGG + Intergenic
967440256 3:189499629-189499651 GAACTGTGGTTGTCAGAGACTGG + Intergenic
968004365 3:195229553-195229575 GAATGATGGTTATCAGAGGCTGG - Intronic
970322689 4:14890813-14890835 GATTCATGGTTGTTTAAGGCTGG - Intergenic
970390935 4:15613165-15613187 GATTCATGGTTATCAGAGGCTGG + Intronic
970982199 4:22112736-22112758 GACTAATAGTTGTCTGAGATAGG + Intergenic
971290925 4:25338561-25338583 GATTCATGGTTGTCAAAGGCTGG - Intronic
972204004 4:36748608-36748630 GAATAGTGGTTGTCAGAGGCAGG + Intergenic
972314199 4:37910626-37910648 GAATGATGGTTACCAGAGACTGG + Intronic
972769956 4:42188536-42188558 GAATCATGGTTACCAGAGGCTGG + Intergenic
972858306 4:43135431-43135453 GAAGCAGGGTGGTCTGAGAAGGG + Intergenic
973074709 4:45908603-45908625 GAATTATGGTTACCTGAGGCTGG + Intergenic
973604685 4:52574983-52575005 GAATGATGGTTACCTGAGGCTGG + Intergenic
975491461 4:74993734-74993756 GATAACTGGTTGTCTGAGACAGG + Intronic
976116318 4:81731732-81731754 GAATGATGCTTATCAGAGACTGG + Intronic
976662560 4:87554821-87554843 GAATGATGGTTGCCAGGGACTGG - Intergenic
977364400 4:96049028-96049050 AAATAATGGTTATCAGAGACTGG - Intergenic
977631744 4:99250674-99250696 GAATGATGGTTACCAGAGACTGG + Intergenic
979174356 4:117643905-117643927 GAATTATGGTTATCAGAGTCTGG - Intergenic
979294740 4:119018636-119018658 GAATGATGGTTACCAGAGACTGG + Intronic
979411173 4:120381660-120381682 GAATGATGGTTATCAGAGGCTGG + Intergenic
979500641 4:121435858-121435880 GAATGATGGTTACCAGAGACTGG - Intergenic
979506733 4:121506258-121506280 GAATGATGGTTATCAGAGGCTGG - Intergenic
979712869 4:123801623-123801645 GAATCATGGTTGCCAGAGAATGG + Intergenic
981012123 4:139936048-139936070 GAATGATGGTTATCTGAGGCTGG - Intronic
981620574 4:146693253-146693275 GATTAATGGTTGCCTGGGACAGG - Intergenic
981798424 4:148627129-148627151 GAATGGTGGTTGTCAGAGAATGG + Intergenic
982145464 4:152384496-152384518 GAATCATGGTTGTCTGAGACAGG + Intronic
983314554 4:166114191-166114213 GAATGATGGTTATCAGAGGCTGG + Intergenic
985423809 4:189809947-189809969 GTATCATGTTGTTCTGAGACAGG - Intergenic
985823576 5:2177486-2177508 GGATCCTGGGTGTCTGAGCCTGG - Intergenic
986028735 5:3875215-3875237 AAAGCATGGGTGTCTCAGACCGG + Intergenic
986149340 5:5112686-5112708 AAATGATGGTTGCCAGAGACTGG - Intergenic
987767678 5:22255052-22255074 GAATGATGGTTACCTGAGGCTGG - Intronic
988521642 5:31950780-31950802 ATATCATGGTTGCCAGAGACTGG - Intronic
989037172 5:37187188-37187210 GAATGGTGGTTGTCAGAGGCTGG - Intronic
990079125 5:51890962-51890984 GAATGATGGTTACCAGAGACTGG + Intergenic
991401242 5:66254023-66254045 CAAACATGTTTGTTTGAGACAGG + Intergenic
993931767 5:93949806-93949828 GAATGATGGTTACCTGAGGCTGG - Intronic
995971403 5:117975270-117975292 GAATGATGGTTATCAGAGGCGGG - Intergenic
996259057 5:121443207-121443229 GAATGATGGTTATCAGAGGCTGG + Intergenic
997014970 5:129922005-129922027 GAATGATGGTTGCCAGAGGCTGG - Intronic
997638825 5:135435252-135435274 GAATCATGGCTGTCTCAGCTGGG + Intergenic
998135874 5:139674236-139674258 GAATCATGGAAATCAGAGACGGG + Intronic
998793353 5:145790452-145790474 GAATGGTGGTTATCTGAGGCTGG + Intronic
998827495 5:146118336-146118358 GAATCATGGTTATCAGAGGCTGG + Intronic
999231119 5:150062436-150062458 GAATCATGGTTGCCAGGGGCTGG - Intronic
999487416 5:152012099-152012121 GATTAGTGGTTGTCTGGGACAGG - Intergenic
1000533585 5:162453528-162453550 GAACCAAGGGTGTCTGAGAAGGG + Intergenic
1002084463 5:176763605-176763627 GAATCATGGTTGCCAGGGGCTGG - Intergenic
1003600809 6:7515398-7515420 GAATCATTGTTTTCTGGCACTGG - Intergenic
1003615711 6:7653543-7653565 GAATCATTGTGGCCAGAGACAGG - Intergenic
1003952548 6:11129200-11129222 GAATGATGGTTATCGGAGTCCGG - Intronic
1006270534 6:32962936-32962958 GAATGATGGTTACCAGAGACTGG + Intronic
1007453735 6:41960207-41960229 GATTCATGGTTGCCAGTGACTGG + Intronic
1008608193 6:53161059-53161081 GAATGATGGTTGTCAGGGGCTGG - Intergenic
1008754306 6:54776103-54776125 GAATCATAATTCTCTGAGACAGG + Intergenic
1008847674 6:55987398-55987420 GAATGATGGTTACCAGAGACTGG - Intergenic
1009575781 6:65457274-65457296 GAAACATAGGAGTCTGAGACAGG - Intronic
1010161862 6:72866151-72866173 AAATCATGTTTGTCTGATTCTGG + Intronic
1010167808 6:72938230-72938252 GATTCATGGTTGCCTAAGCCTGG + Intronic
1012048229 6:94305829-94305851 GATTAATGGTTGCCTGAGATGGG + Intergenic
1012800899 6:103826434-103826456 GAATGATGGTTATCAGAGTCTGG + Intergenic
1013909745 6:115259944-115259966 GAATCATGGTTACCAGAGGCAGG + Intergenic
1013942874 6:115686681-115686703 GAATAGTGGTCTTCTGAGACAGG - Intergenic
1014010406 6:116469201-116469223 TAATCAAGGTGGTCTGAGAATGG + Intergenic
1014152873 6:118078889-118078911 GAGTCATGGCTGTTTAAGACTGG + Intronic
1014648376 6:124004569-124004591 GAATGATGGTTGGATGAAACTGG - Intronic
1017566138 6:155689036-155689058 GAATCATGGCTGGGTGACACCGG + Intergenic
1021370675 7:19841672-19841694 GAAGCATGGTTGTCCTAGATAGG - Intergenic
1021515345 7:21478119-21478141 GAATCATGGTCTTTTGTGACTGG + Intronic
1022210400 7:28203613-28203635 GATTAATGGTTGTCAGGGACTGG + Intergenic
1022276204 7:28857356-28857378 GAACGGTGGTTGTCAGAGACTGG + Intergenic
1022318865 7:29269216-29269238 GAATGATGGTTGCCAGAGGCTGG - Intronic
1022770631 7:33468676-33468698 GAATGATGGTTATCAGAGGCTGG - Intronic
1024423601 7:49199815-49199837 TAATCATGTCTGTCTGAGGCAGG + Intergenic
1025770467 7:64500606-64500628 GAATGATGATTGTCTGGGGCTGG + Intergenic
1025808733 7:64858654-64858676 GAATAATGATTGCCTGCGACAGG - Intergenic
1026397520 7:69971170-69971192 GAAAAATGGTTTTTTGAGACAGG - Intronic
1026615934 7:71904517-71904539 GAATGGTGGTTATCAGAGACTGG + Intronic
1027528133 7:79296701-79296723 GAATGGTGGTTGTCAGAGGCTGG + Intronic
1030318690 7:108142182-108142204 CAATAGTGATTGTCTGAGACTGG - Intergenic
1030567433 7:111176600-111176622 GAATGATGGTTATCAGAGACTGG + Intronic
1030745714 7:113163360-113163382 GAATGATGGTTACCAGAGACTGG - Intergenic
1030966763 7:116002506-116002528 GAACAATGGTTGCCTGAGGCTGG + Intronic
1031084702 7:117291089-117291111 CAATCATGGTTTTCAGAGACTGG - Intronic
1031260466 7:119512210-119512232 GAATCATGTTTACCAGAGACTGG + Intergenic
1031726738 7:125249333-125249355 GAATGATGGTTACCTGAGGCTGG - Intergenic
1031893090 7:127317947-127317969 GAATGGTGGTTGTCAGAGGCTGG + Intergenic
1032732003 7:134652641-134652663 GAATTATGGTTGCCAGAGGCAGG - Intronic
1033317613 7:140310849-140310871 GATTAGTGGTTGTCTGAGGCTGG - Intronic
1035176126 7:157052448-157052470 GATTCGTGGTTGTCTAGGACGGG + Intergenic
1035530141 8:344856-344878 CACTCATGGTCGTCTGAGATAGG + Intergenic
1036398810 8:8390194-8390216 GGATCATGGTTTTTGGAGACAGG + Intergenic
1039660893 8:39463612-39463634 GAATCATGGTTGCCAGAGCCTGG + Intergenic
1041378210 8:57223840-57223862 GAGACATGGTTGTCTTAGACAGG + Intergenic
1041745907 8:61209204-61209226 GAATCATGGATGTGTAAGGCAGG + Intronic
1041966043 8:63678217-63678239 GTTTCATGGTTGTCTGGGACAGG - Intergenic
1042307426 8:67346086-67346108 GTATCATGCTTGTCTTAGCCTGG - Intergenic
1042598405 8:70473584-70473606 GAATGATGGTCGTCTGGGGCTGG - Intergenic
1043346663 8:79305478-79305500 GAATGATCGTTGTCAGAGGCTGG - Intergenic
1043658470 8:82704285-82704307 GAAGGATGGTTATCAGAGACTGG + Intergenic
1043744546 8:83857016-83857038 GAATGATGGTTCTCTGAGGCTGG + Intergenic
1043771499 8:84207539-84207561 GAATCATGGTTGCTTGGGAATGG + Intronic
1044160525 8:88908950-88908972 GAATGGTGGTTGCCAGAGACTGG + Intergenic
1044850847 8:96425877-96425899 GAATGATGGTTGCCAGAGGCTGG - Intergenic
1045662628 8:104454010-104454032 GAATAGTGGTTGTCTGGGGCTGG + Intronic
1046149784 8:110208682-110208704 GAATGGTGGTTATCAGAGACTGG - Intergenic
1046571119 8:115967474-115967496 GAATCATGGCCCTCTGAGAGTGG + Intergenic
1046721276 8:117621434-117621456 CAATAATGGGTGACTGAGACTGG - Intergenic
1047525542 8:125631061-125631083 GAATAGTGGTTACCTGAGACTGG + Intergenic
1048052124 8:130828176-130828198 GAGACATGGCTGTCTCAGACAGG - Intronic
1048085641 8:131175601-131175623 GAATGATGGTTACCTGAGGCTGG + Intergenic
1049712620 8:144072573-144072595 GAATCATGGTCCCCAGAGACTGG - Intergenic
1050580949 9:7055880-7055902 GAATCAAGGTTGTATTTGACAGG + Intronic
1051726559 9:20092885-20092907 GAATGATGGTTGCCAGGGACTGG + Intergenic
1052812140 9:33070847-33070869 GAAGGATGGTTGTCAGAGGCTGG + Intronic
1053046154 9:34919467-34919489 GAATGATGGTTATCAGAGGCTGG - Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1053184198 9:36001476-36001498 GAATGATGGTTATCAGAGGCTGG + Intergenic
1055478155 9:76684254-76684276 GAATGGTGGTTGCCAGAGACTGG - Intronic
1055670756 9:78603760-78603782 GAATGATGGTTTTCAGAGGCTGG + Intergenic
1058226393 9:102369823-102369845 GAATAGTGGTTGTCAGAGGCTGG + Intergenic
1059115705 9:111598964-111598986 GAATGATGGTTGCCAGAGGCTGG - Intronic
1059204456 9:112450952-112450974 CAATCATGGGTGGCTGAGGCGGG + Intronic
1061586026 9:131569156-131569178 GATTCATGGTTGTCTGGAAGTGG - Intergenic
1062526420 9:136979717-136979739 GAATCCTGGTTTTCTGAGCCTGG + Intronic
1186081163 X:5934063-5934085 GACTCATGGTTGTCAGGGACTGG - Intronic
1186373827 X:8976357-8976379 GAATGATGGTTGTGAGAGACTGG + Intergenic
1186806151 X:13142021-13142043 AAATGATGGTTCCCTGAGACTGG + Intergenic
1186910066 X:14153827-14153849 GAATGATGGTTATCAGAGGCTGG - Intergenic
1186911139 X:14167636-14167658 GAAGCATGGTTACCAGAGACTGG - Intergenic
1186972909 X:14868558-14868580 GAATACTGGTTATCAGAGACTGG + Intronic
1187943475 X:24403818-24403840 GAATGATGGTTGCCAGGGACTGG - Intergenic
1188265890 X:28073781-28073803 GAATGATGGTTACCAGAGACTGG - Intergenic
1188648947 X:32606189-32606211 GAAGGATGGTTATCAGAGACTGG - Intronic
1188885977 X:35549581-35549603 GATTGCTGGTTGTCAGAGACTGG - Intergenic
1189738996 X:44099608-44099630 GAATGGTGGTTGTCAGAGGCTGG - Intergenic
1189822353 X:44882622-44882644 GAATCATAGTTGCTTGAGTCTGG + Intronic
1190857069 X:54306609-54306631 GAATGATGGTTACCAGAGACTGG + Intronic
1192045356 X:67666222-67666244 GAATGATGGTTATCAGAGGCTGG - Intronic
1192303709 X:69934960-69934982 GAATGATGGTTATCAGAGGCTGG - Intronic
1192637728 X:72835629-72835651 GAATGATGGTTGCCAGAGGCTGG + Intronic
1192643986 X:72885186-72885208 GAATGATGGTTGCCAGAGGCTGG - Intronic
1193920665 X:87421858-87421880 GAATGATGGTTGCCAGAGACTGG - Intergenic
1194451595 X:94050486-94050508 GAATCCTGAATATCTGAGACAGG + Intergenic
1194640949 X:96403661-96403683 GAATCATGGTTTTATGTGACAGG + Intergenic
1195380912 X:104269934-104269956 GAATGGTGGTTATCAGAGACTGG + Intergenic
1195645307 X:107224589-107224611 GAATGATGGTTACCAGAGACTGG + Intronic
1196149685 X:112359421-112359443 GAATGATAGTTATCAGAGACTGG - Intergenic
1197985383 X:132261357-132261379 GAATGATGGTTGTCGGGGGCTGG + Intergenic
1198504143 X:137284478-137284500 GAATCATGGTTACCAGAGGCTGG + Intergenic
1199029404 X:142979293-142979315 GAATGATGGTTGTCTGGGCCTGG + Intergenic
1199261002 X:145774861-145774883 GAATGATGGTTACCAGAGACTGG - Intergenic
1200368310 X:155692110-155692132 GAATGATGGTTACCAGAGACTGG + Intergenic