ID: 982146199

View in Genome Browser
Species Human (GRCh38)
Location 4:152395847-152395869
Sequence GTGAAAAATAGGTGGTCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982146195_982146199 -8 Left 982146195 4:152395832-152395854 CCTACATGATGTCTAGTGAAAAA 0: 1
1: 0
2: 3
3: 23
4: 259
Right 982146199 4:152395847-152395869 GTGAAAAATAGGTGGTCTATGGG 0: 1
1: 0
2: 0
3: 8
4: 124
982146193_982146199 4 Left 982146193 4:152395820-152395842 CCATTCTTCTTCCCTACATGATG 0: 1
1: 0
2: 1
3: 21
4: 304
Right 982146199 4:152395847-152395869 GTGAAAAATAGGTGGTCTATGGG 0: 1
1: 0
2: 0
3: 8
4: 124
982146194_982146199 -7 Left 982146194 4:152395831-152395853 CCCTACATGATGTCTAGTGAAAA 0: 1
1: 0
2: 2
3: 13
4: 137
Right 982146199 4:152395847-152395869 GTGAAAAATAGGTGGTCTATGGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982146199 Original CRISPR GTGAAAAATAGGTGGTCTAT GGG Intronic
902191582 1:14766927-14766949 GAGAAATATATGTGGTCTAGGGG + Intronic
905164677 1:36072778-36072800 GTGAAAAATGGGTGGGGTAGAGG - Intergenic
914955004 1:152154191-152154213 GTGAAATCTAGGTGGTAAATTGG - Exonic
919226642 1:194711713-194711735 ATGAAAATTAAGTGGTCTCTGGG - Intergenic
919237992 1:194871063-194871085 GTGAAAAGTAGGACATCTATAGG + Intergenic
920393926 1:205630419-205630441 CTGAAAAATAGTTGGGCTATGGG - Intronic
920550704 1:206858506-206858528 GTGGAAAAGATGTGGTCTCTTGG - Intergenic
924548615 1:245053533-245053555 GTGAGATATAGGTGGGCTAGTGG + Intronic
1062941527 10:1425280-1425302 CTGAGAAACAGGTGGTATATAGG - Intronic
1064400404 10:15016321-15016343 GGGAAAAATACTTTGTCTATGGG + Intergenic
1064442055 10:15362968-15362990 GACAAAAAGAGGTGGTCTGTCGG - Intronic
1067501574 10:46809698-46809720 GTGAAAAACAGGTGGTGGAAAGG + Intergenic
1067593002 10:47530211-47530233 GTGAAAAACAGGTGGTGGAAAGG - Intronic
1067640116 10:48038314-48038336 GTGAAAAACAGGTGGTGGAAAGG - Intergenic
1068479128 10:57566816-57566838 TTGAAGAATATGTGGTCTTTAGG - Intergenic
1068547817 10:58370991-58371013 GAGAGAAATAGGTAGTCTTTTGG + Intergenic
1068759399 10:60690955-60690977 GTTAAAAAATAGTGGTCTATGGG - Intronic
1070137081 10:73704355-73704377 GTGAAAAACAGGTGGTGGAAAGG - Intergenic
1071983055 10:91023183-91023205 GGGAAAACTAGCTGGTATATTGG - Intergenic
1078162936 11:8857587-8857609 GCTGGAAATAGGTGGTCTATTGG - Intronic
1079103541 11:17556562-17556584 GTGTAAAATTGATGGCCTATAGG + Intronic
1080276633 11:30510455-30510477 ATGAAAAAGAGGTGCTGTATTGG - Intronic
1081487240 11:43540793-43540815 TTTATAAAGAGGTGGTCTATGGG - Intergenic
1087809223 11:102592264-102592286 GAGAAAAATAGCTGGCCTAGTGG + Intronic
1089121175 11:116136650-116136672 ATGAAAAACAGGTGGTCCCTGGG + Intergenic
1090118246 11:123997494-123997516 GTGAAAAATGAGTGGTCATTTGG - Intergenic
1091351273 11:134897794-134897816 GAGAAGAACAGGTGGTCTACTGG + Intergenic
1093507067 12:19880056-19880078 GTAAAATATACCTGGTCTATAGG + Intergenic
1096644925 12:53027451-53027473 TTAAAAAATAAGTGGTCTTTGGG + Intronic
1098335089 12:69395992-69396014 CTGAAATCTAGGTGGTCAATTGG - Intergenic
1099216326 12:79858289-79858311 GTGAAAAATAGGTAAGCTCTTGG - Intronic
1100202234 12:92311824-92311846 GTGAAAATTATGTGGCCAATTGG + Intergenic
1100704864 12:97189415-97189437 GTGAAAAGTTGTTGGTGTATGGG + Intergenic
1108468147 13:50739635-50739657 GTAAAAAATAGGTGGATTAGAGG + Intronic
1108472787 13:50784277-50784299 GTGAAAAATACCTGGTCTGTAGG - Intronic
1112282855 13:98077764-98077786 GTGAAAAATTGGTGGTAGAATGG - Intergenic
1115406380 14:33021608-33021630 TTGAAAAATAGGTGGGATTTAGG - Intronic
1116237832 14:42303256-42303278 GTGAAAAGTAAGTGGTCAAGTGG - Intergenic
1116337074 14:43670180-43670202 GTTAAATATAAGTGGTGTATTGG + Intergenic
1116496145 14:45563075-45563097 GTGAAAAATATCTGTTCTTTTGG + Intergenic
1117667416 14:58071074-58071096 GTGAAAAATAAATGTTCTTTTGG + Intronic
1117855540 14:60028213-60028235 TTGAAATATAGATGGTATATAGG - Intronic
1118281901 14:64436888-64436910 GTAAAAAATAGCTAGTCAATAGG - Intronic
1120306533 14:82778251-82778273 GTGAAGAATAAATGGTCCATTGG + Intergenic
1120423853 14:84322420-84322442 ATGAAAATAAGGTGGTCAATGGG + Intergenic
1126931703 15:53660479-53660501 GTAAAAAACAGCTGGTGTATTGG - Intronic
1129476927 15:75791912-75791934 GTGAAAAAAAGGCGGTGGATAGG - Intergenic
1130037565 15:80375685-80375707 GAGAAAACTTGGTGGTCTATGGG - Exonic
1130682005 15:86005176-86005198 GGGAAAAATAGGTGGGCTTAAGG + Intergenic
1131433969 15:92408455-92408477 GTGGAAAGTAGGTGCTCTTTTGG + Intronic
1134374999 16:13663915-13663937 GTGCATAATAGGTGCTCAATAGG + Intergenic
1149794573 17:59507525-59507547 GTGAGCAATAGGTGATCTAACGG + Intergenic
1152847341 17:82609713-82609735 GTGAACAATAAGGGGCCTATGGG + Intronic
1153257640 18:3188300-3188322 ATGAAGAATATGTGGTCTTTTGG - Intronic
1154405348 18:14085561-14085583 GCTAAAAACAGGTGCTCTATTGG - Intronic
1154960780 18:21306338-21306360 ATGATAATTAAGTGGTCTATGGG + Intronic
1166658346 19:44628440-44628462 GTGAAATATAGATAGTATATTGG + Intronic
1167071116 19:47222427-47222449 ATGAAAACAAGGTGGTCTCTAGG + Intronic
925239226 2:2308153-2308175 GTGAAGAGTAGGTGGAGTATGGG - Intronic
925239247 2:2308377-2308399 GTGAAGTATAGGTGGAGTATGGG - Intronic
929713751 2:44290659-44290681 CTTAAAAATAAGTAGTCTATAGG - Intronic
929870997 2:45759224-45759246 GTGACAAATAAGTGGTATGTGGG + Intronic
932025279 2:68125973-68125995 TTGAAAAATATGTGGGCAATTGG - Intronic
932957226 2:76366590-76366612 GATAAAAATAGGTGGAGTATAGG - Intergenic
934508915 2:94920826-94920848 TTGAGAAATAGGTGGTGTTTGGG - Intergenic
935919696 2:107999664-107999686 GAGAAAAGAAGGTGGTCTAAGGG - Intronic
939689537 2:145240634-145240656 GAGAAAAATGGGTTGCCTATGGG + Intergenic
939819623 2:146940721-146940743 GTAAAGAATTTGTGGTCTATGGG - Intergenic
940352633 2:152706269-152706291 GTGAAAAATAGGTGTTTTAGAGG - Intronic
944543826 2:200779555-200779577 GTCACAAATTGGTGGTCTACTGG + Intergenic
946669362 2:222085896-222085918 GTGAAAGAGAGGAGGTCTTTTGG + Intergenic
1171107860 20:22452695-22452717 CTGAAAACTAGCTGGTCTGTTGG - Intergenic
1174840816 20:53899698-53899720 GTGAAACACAGCTGGTTTATAGG + Intergenic
1178015707 21:28343742-28343764 ATAAAAAAAAGGTGATCTATGGG - Intergenic
1182175172 22:28278522-28278544 CTGAAAAATAGGAAGCCTATAGG - Intronic
1183804564 22:40197229-40197251 GTGCAGAATAGGAGGTCTTTGGG + Intronic
953234729 3:41096193-41096215 TTGAAAAATGTGTGGTCTATTGG - Intergenic
957581980 3:82085870-82085892 GAGTAAAATAGGTAGGCTATTGG - Intergenic
958813437 3:98889966-98889988 GTGAGAAAAAGGTGGTAGATGGG - Intronic
960692385 3:120360439-120360461 CTGAAAAATATGTGCTCTGTGGG - Intergenic
963262222 3:143204496-143204518 GTGAAAAATTGGGGTTCTGTTGG - Intergenic
964105197 3:153031576-153031598 GAGAAAAATGAGTTGTCTATTGG - Intergenic
964678589 3:159312305-159312327 GTGAGAAAGTGGTGATCTATGGG + Intronic
964896138 3:161598644-161598666 GTGAAAAATAGCCTGGCTATAGG + Intergenic
967798474 3:193626421-193626443 CTGAAAATTAGGTTGTCTGTAGG + Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
979053045 4:115958888-115958910 GGGAAAAATAGATGCTTTATGGG + Intergenic
980718140 4:136655511-136655533 GTGTAAAGTAGGTGGTTTGTTGG + Intergenic
981405310 4:144360822-144360844 GGGAGAAATAGGTGGTAAATAGG + Intergenic
982146199 4:152395847-152395869 GTGAAAAATAGGTGGTCTATGGG + Intronic
983929860 4:173441495-173441517 GAGAAAAATAAGAGGTCTACAGG - Intergenic
989244709 5:39241535-39241557 GTGATAAATAGGTGGTAGAAAGG + Intronic
990438517 5:55820531-55820553 GTGAAAAACTGGTTGTATATGGG + Intergenic
992356421 5:75989121-75989143 AAGAAAAAAAGGTGGTTTATTGG - Intergenic
994595281 5:101824940-101824962 GAGGAAAATATGTGGTATATGGG - Intergenic
995045741 5:107644426-107644448 GTGAACAAAACATGGTCTATCGG + Intronic
998898778 5:146829750-146829772 GTGAAAAAATGGAGGTCTGTAGG - Intronic
999953555 5:156676207-156676229 ATGAAAAATAGGTACTCAATTGG - Intronic
1000110772 5:158106206-158106228 GTATAAAATAGGGGGTTTATAGG + Intergenic
1003252059 6:4437711-4437733 GAGCAAAATAGCTGGTCTATTGG - Intergenic
1006877046 6:37306668-37306690 GTGAAAACTTGGTGGTATGTTGG + Intronic
1007698028 6:43746307-43746329 GTGAAAATTCAGTGGTCTCTGGG + Intergenic
1010545182 6:77145672-77145694 GTGAAAAATATGTGGTATAAAGG + Intergenic
1012842992 6:104353860-104353882 GTGAAGATTATATGGTCTATGGG - Intergenic
1015251584 6:131133564-131133586 GTGAAAAATATGTGGCATTTGGG + Intergenic
1015442320 6:133263432-133263454 GTGGAAAAAAGCTGGTCTGTAGG - Intronic
1016660640 6:146575213-146575235 GTGAAAAATGAGTTGGCTATAGG - Intergenic
1021380558 7:19961053-19961075 CTGAAAAACAGGTGGTCATTAGG + Intergenic
1026612849 7:71875712-71875734 GTGAAAAAGAGGTGGGGTAAGGG + Intronic
1030945474 7:115714236-115714258 CTGAAAAATATGTGGGCAATTGG - Intergenic
1031453872 7:121955954-121955976 GTGAAAGATAGGAGGACTTTGGG + Intronic
1031600443 7:123701421-123701443 TTGAAAAACAGGTGGCCTAGAGG + Intronic
1031809677 7:126350512-126350534 CTGGAAAAAAGGTGGTATATGGG + Intergenic
1034852069 7:154502631-154502653 TTAAAAAGTAGGTGGTTTATTGG - Intronic
1035330185 7:158091740-158091762 GTGAAAGATAGGTGATGGATGGG + Intronic
1038881113 8:31613123-31613145 TTGAAAAAAAGGTGGAGTATGGG + Intergenic
1041608165 8:59810222-59810244 GTGAAAGATAGATGGCTTATGGG - Intergenic
1044073366 8:87789410-87789432 GGGAAAAACAGGTGCTTTATGGG - Intergenic
1044704021 8:94991066-94991088 GTGAAAAATGACTGGTCTAAGGG + Intronic
1053187160 9:36026322-36026344 TTGAAAAATATGTGGGCTCTGGG - Intergenic
1058160260 9:101562830-101562852 TTAAAAAATAAGTTGTCTATGGG + Exonic
1058453759 9:105120382-105120404 GTGAAGAAAATGAGGTCTATAGG + Intergenic
1060601445 9:124880944-124880966 TTGAAAAATACGTGGCCTGTTGG + Intronic
1185576038 X:1173062-1173084 TTGAAAATTAAGTGGTCAATTGG - Intergenic
1186148136 X:6646256-6646278 CGGAAATATAGGTGGTCTCTGGG - Intergenic
1188487263 X:30696184-30696206 GTTATAAATAGGTAGTGTATTGG - Intronic
1190821317 X:53975735-53975757 ATGAAAAATAGTTGGTTAATGGG + Intronic
1191641014 X:63429819-63429841 GGGAAAAGGAGGTGGTCTAAGGG + Intergenic
1195426890 X:104743841-104743863 CTTAAAAATATGTGGTCTAAAGG - Intronic
1197621296 X:128752720-128752742 GTGAAAAATAGATTGTCAGTAGG + Intergenic
1199771906 X:150980652-150980674 GGGAGAAATAGATGGTCAATGGG + Intronic
1199841279 X:151652142-151652164 GTGAAAAATTGTTGCTCTAGAGG + Intronic
1200775475 Y:7166728-7166750 GTGAAAAAAAGGTTGTCCGTAGG - Intergenic