ID: 982146482

View in Genome Browser
Species Human (GRCh38)
Location 4:152400363-152400385
Sequence AAAAGTCATGTCTATACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 9, 3: 82, 4: 354}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982146482_982146486 -7 Left 982146482 4:152400363-152400385 CCTTGGGTATAGACATGACTTTT 0: 1
1: 0
2: 9
3: 82
4: 354
Right 982146486 4:152400379-152400401 GACTTTTTGCTGGGGTAGAGTGG 0: 1
1: 0
2: 1
3: 15
4: 197
982146482_982146487 4 Left 982146482 4:152400363-152400385 CCTTGGGTATAGACATGACTTTT 0: 1
1: 0
2: 9
3: 82
4: 354
Right 982146487 4:152400390-152400412 GGGGTAGAGTGGTATGATCTTGG 0: 1
1: 3
2: 277
3: 5212
4: 46332
982146482_982146488 29 Left 982146482 4:152400363-152400385 CCTTGGGTATAGACATGACTTTT 0: 1
1: 0
2: 9
3: 82
4: 354
Right 982146488 4:152400415-152400437 CACCACATCCTTGATGTCCCAGG 0: 1
1: 0
2: 14
3: 163
4: 1572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982146482 Original CRISPR AAAAGTCATGTCTATACCCA AGG (reversed) Intronic
900077427 1:828734-828756 AAAACTCATGGCCAAACCCAAGG + Intergenic
901170317 1:7252374-7252396 AAAATCCATGTCCATGCCCATGG - Intronic
903655520 1:24946858-24946880 AAAAGCCTTGTCTACACCCAAGG + Intronic
903885225 1:26537113-26537135 ACAAGTGATTTCTATGCCCAGGG - Intronic
905119463 1:35670649-35670671 GAAAGTCATGACTATGGCCAGGG - Intergenic
905683710 1:39893553-39893575 AACATTCATGCCTGTACCCATGG + Intergenic
906666509 1:47625928-47625950 AAAAGTCATGTCATTTGCCAAGG + Intergenic
906913744 1:49984410-49984432 AAATGTTAAGTCTCTACCCAGGG + Intronic
908038537 1:60082429-60082451 AAAAGTCCTGCATATACACAAGG - Intergenic
909016925 1:70390048-70390070 AAAAGACATGTCTAGACTGAAGG + Intergenic
909098311 1:71317757-71317779 AAAAGTCATCACTATGCCCAAGG - Intergenic
910653935 1:89600781-89600803 AATAGTCATGGCCATATCCAAGG - Intergenic
910768081 1:90802634-90802656 AAAAGTCATTGCTAAACCCAAGG + Intergenic
911439589 1:97908633-97908655 TAAAGTCAAGACTATAACCAAGG - Intronic
911549067 1:99257846-99257868 ACAAGACATATCTGTACCCATGG + Intergenic
911680174 1:100706304-100706326 AAAAGTAAAGTATATACCTAGGG - Intergenic
911868714 1:103063638-103063660 AAGAGTCATCACCATACCCAAGG - Intronic
911999124 1:104808039-104808061 AAAAGTCATCACCAAACCCATGG - Intergenic
912854724 1:113157133-113157155 AAAAGTTATCACCATACCCAAGG + Intergenic
913664988 1:121039562-121039584 AAAAGTCATCACCAAACCCAAGG - Intergenic
914016380 1:143822836-143822858 AAAAGTCATCACCAAACCCAAGG - Intergenic
914161404 1:145138165-145138187 AAAAGTCATCACCAAACCCAAGG + Intergenic
914454425 1:147822650-147822672 ATAAGTCTTATCTATAGCCACGG + Intergenic
916865701 1:168855537-168855559 AAAAGTCATTGCCATACTCAAGG - Intergenic
917178946 1:172271933-172271955 AAAACTCATATCTATCACCATGG - Intronic
917254132 1:173096542-173096564 TAATCTCTTGTCTATACCCAGGG + Intergenic
918051779 1:180979621-180979643 AAAAGTCATTGCCATACCCAAGG - Intronic
918539952 1:185620921-185620943 AAAAGTCATCTCCAACCCCAAGG - Intergenic
919292581 1:195651083-195651105 AAAAGTCATTGCCATAACCAAGG - Intergenic
919632220 1:199970548-199970570 AAAAGTCATATCAATTCTCAGGG + Intergenic
920509124 1:206537772-206537794 AAAAGTCAAGTCCTTCCCCAGGG + Intronic
921093150 1:211862387-211862409 AAAAGTCATTGCCAAACCCAAGG + Intergenic
921972380 1:221164114-221164136 AAAAGTCTTGTGTATGGCCAGGG + Intergenic
922538111 1:226398095-226398117 AAAAGTCATCACCAGACCCAAGG - Intronic
924020883 1:239780671-239780693 AAAAGTCATCACCAAACCCAAGG + Intronic
924286034 1:242487472-242487494 AAAAGTCATCACCAAACCCAAGG - Intronic
924947190 1:248854514-248854536 GAAAATCATATATATACCCATGG - Intronic
1062999527 10:1902389-1902411 AAAAGTCATTGCTAAATCCAGGG + Intergenic
1064700666 10:18017203-18017225 AAAAGTCATTGCTATACCTAAGG + Intronic
1064789996 10:18947082-18947104 AAAAGTCATTGCCAAACCCAAGG + Intergenic
1065197951 10:23284922-23284944 AAAATGCATGTATATACCTATGG - Intronic
1065520994 10:26572374-26572396 AAAAGTCACTGCCATACCCAAGG + Intergenic
1065530000 10:26659617-26659639 AAAAGTCATTGCCATGCCCAAGG + Intergenic
1065556952 10:26925535-26925557 AAAAGTCATTGCCATGCCCAAGG - Intergenic
1066185973 10:33010761-33010783 AAATATCATGTCTACACTCAGGG + Intergenic
1066485601 10:35840405-35840427 AAAACACATCACTATACCCAAGG + Intergenic
1068173898 10:53431485-53431507 AAAAATCATGTCTGTCACCAAGG + Intergenic
1068259989 10:54567391-54567413 AAAAGTCATTGCCATACTCAAGG + Intronic
1068563999 10:58550495-58550517 AAAACTCATCACTAAACCCAAGG + Intronic
1068786818 10:60985478-60985500 AAAAGTCATGGCCATATACAAGG - Intronic
1069796341 10:71054162-71054184 AAAAGTTATTGCCATACCCAAGG - Intergenic
1070852516 10:79578137-79578159 AAAAGTCATTGCCAAACCCAAGG - Intergenic
1070996841 10:80791804-80791826 AAAAGTCATTGCCATACTCATGG + Intergenic
1071232827 10:83608930-83608952 AAAAGTCATCCCCAAACCCAGGG + Intergenic
1071704785 10:87985811-87985833 AAAAGTCATCGCCATACCCAAGG - Intergenic
1071998461 10:91170203-91170225 AAAAGTCATCACCAAACCCAAGG - Intronic
1072329643 10:94335149-94335171 AGAATACATGTCTATACCCATGG + Intronic
1072341277 10:94453678-94453700 AAAAGTCATCACCATACTCAAGG + Intronic
1073782288 10:106851256-106851278 AAAAGTCATCACCATATCCAAGG + Intronic
1074052581 10:109893639-109893661 AAATGTCATGTCCAAAACCAAGG + Intronic
1074686908 10:115970144-115970166 AGAAGTCAGGACTTTACCCAGGG + Intergenic
1074918070 10:117978032-117978054 AAAAGGCATCACCATACCCAGGG - Intergenic
1075048051 10:119161660-119161682 AAAAGTCCTGTCTCTACCCTTGG + Intronic
1075371616 10:121940973-121940995 AAAAGTCATCACTAAACCCAAGG - Intergenic
1076622081 10:131796330-131796352 AAAAGTCATCACTATACTGAAGG + Intergenic
1078050227 11:7959034-7959056 AAAAGTCATCGCCAAACCCAAGG + Intergenic
1078904635 11:15672282-15672304 AAAAGTAAAGACAATACCCAGGG - Intergenic
1079821086 11:25129553-25129575 AAAAGTCATCACCAAACCCAAGG + Intergenic
1080812565 11:35719607-35719629 AAAAGTTATCACTATACCCAAGG + Intronic
1083798980 11:65035407-65035429 AACAGGCTTGTCTATGCCCATGG + Intronic
1084766757 11:71314525-71314547 AAAACTCATCTCCAAACCCAGGG + Intergenic
1085555369 11:77414825-77414847 AAAAGTCATTGCCAAACCCAAGG - Intronic
1086153316 11:83637845-83637867 GAAAGTCCTGTCTATACAGAAGG - Intronic
1086172742 11:83854676-83854698 AACAGTCATCTCAAAACCCAAGG - Intronic
1087300261 11:96424922-96424944 AAAAGTCATCACCAAACCCAGGG + Intronic
1087539971 11:99504207-99504229 AAAACACTTGTCTAAACCCATGG - Intronic
1088555986 11:111061318-111061340 AGAAGTCATCACCATACCCAAGG - Intergenic
1088983876 11:114888719-114888741 GAAAGAGATGTCTATACCCAAGG - Intergenic
1090544207 11:127745120-127745142 AAAAGTGATGGCCAAACCCAAGG + Intergenic
1092822650 12:12367406-12367428 AAAGGTAATCTCTAAACCCAGGG + Intronic
1093109638 12:15134155-15134177 AAAAGTCACCACCATACCCAAGG + Intronic
1093140400 12:15503835-15503857 AATCGACTTGTCTATACCCAGGG + Intronic
1093222688 12:16442375-16442397 AAATGTCATCACGATACCCAAGG + Intronic
1093261279 12:16940722-16940744 AAATCTCATCTCTATACCCCTGG + Intergenic
1093759055 12:22885618-22885640 AAAAGTCATTACCATACACAAGG + Intergenic
1094145437 12:27223735-27223757 AAAAGTCATTGCCATACCCAAGG - Intergenic
1094789385 12:33893821-33893843 AAAAGTCATCACCAAACCCAAGG - Intergenic
1095139681 12:38646146-38646168 CAAAGTCATTACTATACCAATGG + Intergenic
1095192812 12:39277717-39277739 GCAAGTCATCTCCATACCCATGG - Intergenic
1095634316 12:44414661-44414683 AAAACTTATCTCTAAACCCAAGG - Intergenic
1096233621 12:49911144-49911166 AAAAGTCAGTTCTTTCCCCAGGG + Intergenic
1096568531 12:52502200-52502222 AAAAGTCATCACCATACCCAAGG + Intergenic
1096932775 12:55232773-55232795 AAAAGTCATTGCCATACCCAAGG - Intergenic
1096998133 12:55852737-55852759 AAAAGTCATTTCCATACCCAGGG - Intergenic
1098574640 12:72027433-72027455 AATAGTCATATCTATAACCTGGG - Intronic
1098922737 12:76317384-76317406 AAAACTCATCACCATACCCAAGG - Intergenic
1099017405 12:77360408-77360430 AAAAGTCATTGCTAAACCCTAGG + Intergenic
1099482331 12:83183454-83183476 AAATGTCATTGCCATACCCAAGG + Intergenic
1099728418 12:86465305-86465327 AAAAGTCATCACCATACCCAAGG - Intronic
1100393597 12:94165237-94165259 AAAAGTGAGGTTAATACCCAGGG - Intronic
1100504159 12:95203618-95203640 AAAAGTGATGCCTACTCCCAAGG - Intronic
1101649535 12:106662623-106662645 AAAAGTCATCATCATACCCAAGG + Intronic
1101865825 12:108518707-108518729 GAAGGTCATGTCCATCCCCAAGG + Exonic
1102569941 12:113821295-113821317 AAAACTCAGGTGTAGACCCACGG - Intronic
1102778130 12:115538975-115538997 CAAAGTCACTTCTATACTCAAGG + Intergenic
1104371985 12:128231569-128231591 AAAAGTCATGCCCATTCACAAGG + Intergenic
1104710918 12:130985421-130985443 ATAAGTCATCACTAAACCCAAGG + Intronic
1105670354 13:22606632-22606654 AAAAGTCATTGCTAAACCCAAGG - Intergenic
1105893905 13:24702095-24702117 AAAATTCCAGTTTATACCCATGG + Intronic
1106174043 13:27313368-27313390 AAAAGTCATCGCCAAACCCAAGG + Intergenic
1106645180 13:31626208-31626230 TAAAGTAATTTCTATACTCATGG + Intergenic
1108326114 13:49333450-49333472 AACAGTCTCATCTATACCCATGG + Intronic
1108821048 13:54350390-54350412 AAAATTCAGGTCTATTCCAAGGG + Intergenic
1108941232 13:55956572-55956594 AAAAGTGTTTGCTATACCCAAGG - Intergenic
1109617035 13:64848627-64848649 AAAAGTCTTGTCTATAAATATGG + Intergenic
1110945452 13:81409385-81409407 AAAAGTCATCTCCAAACCCAAGG + Intergenic
1110969366 13:81741449-81741471 AAAAGTCTTGAATATACACAGGG + Intergenic
1111842094 13:93462420-93462442 TCAAGTCTTATCTATACCCAGGG - Intronic
1112070848 13:95848358-95848380 AAAAGTCATTGACATACCCAAGG + Intronic
1112324619 13:98435236-98435258 AAAAGAAAAGTCTCTACCCAGGG + Intronic
1113918752 13:113891724-113891746 AAAAGTTATTGCCATACCCAAGG + Intergenic
1113971195 13:114191159-114191181 AAAAGTCATTCCCATACTCATGG - Intergenic
1114920634 14:27323675-27323697 AAAAGTCATTATTATACCCAAGG + Intergenic
1115011244 14:28547867-28547889 AAAAGTCATCACCATACCCAAGG + Intergenic
1115147562 14:30242780-30242802 AAAATTCAGTTCTATATCCAAGG + Intergenic
1115169441 14:30487588-30487610 AAAAGTCATCACTATACCCAAGG - Intergenic
1115363284 14:32528011-32528033 AAAAGTCATTGCCAAACCCAAGG + Intronic
1116442557 14:44969609-44969631 AAAAGTCATCACCATACCCAAGG + Intronic
1116645264 14:47520046-47520068 AAATGCCATGTCTATACACCTGG + Intronic
1117017962 14:51538066-51538088 AAAAGTCATCACTGCACCCAAGG + Intronic
1117505026 14:56393386-56393408 AAAAGTCATCTCCATACCCAAGG - Intergenic
1117860838 14:60091415-60091437 AAAAGTTATCCCTATACCCAGGG - Intergenic
1117873379 14:60223994-60224016 AAAAGTCATGTGTCCACCCAGGG + Intergenic
1118551850 14:66960797-66960819 AAAGGTCAGGTTTATGCCCAGGG - Intronic
1119195103 14:72711953-72711975 AAAGGTCATTTCTATCCCAAAGG + Intronic
1120718626 14:87866984-87867006 AGAAGTCCTTTCAATACCCAGGG - Intronic
1121150213 14:91626225-91626247 AAAAGTAATTGCCATACCCAAGG - Intronic
1122360424 14:101157334-101157356 AAAAGTCATCTCCAAACCTAAGG + Intergenic
1123969883 15:25497727-25497749 AAAAGTCATCACCATACCCAAGG - Intergenic
1125858397 15:42973831-42973853 AAAAGTCATCTCCATACCTAAGG + Intronic
1126016711 15:44358776-44358798 AAAAGTCATTGCCATACCCAAGG - Intronic
1126204182 15:46024253-46024275 AAAAGCCATTTCCAAACCCAAGG + Intergenic
1126658538 15:51007854-51007876 AAAAGTCATTGCTAAACCCAAGG + Intergenic
1127127704 15:55829109-55829131 AAAAGTGATGACTATACCAATGG + Exonic
1127217976 15:56844987-56845009 GAAAGCCATGTGCATACCCAAGG + Intronic
1128470913 15:67951904-67951926 AAAAGTCATGACCATAGCCCAGG - Intergenic
1131122977 15:89834586-89834608 AAAAGGCTTGGCTATACCAAAGG + Exonic
1132255905 15:100375240-100375262 AAAAGTCATCTTCAAACCCAAGG + Intergenic
1133928932 16:10216423-10216445 AGAAGTCATCTCTATTCACATGG + Intergenic
1135915902 16:26605277-26605299 AAAAGCCATCTCTAGACCCCTGG + Intergenic
1137628617 16:49925846-49925868 AAAAGTCATTGCCAAACCCAAGG - Intergenic
1137807757 16:51323371-51323393 CAAAGGCATGCATATACCCATGG + Intergenic
1138355717 16:56378528-56378550 AAAAGTCATTGCCATACCCTAGG - Intronic
1139515195 16:67448732-67448754 AAAAGTCCTGCCTCTCCCCAAGG + Intronic
1140243182 16:73223149-73223171 AAAAGTCATCGCCAAACCCAAGG - Intergenic
1140568802 16:76077437-76077459 AGAAGTCATTGCCATACCCAAGG + Intergenic
1144048291 17:11473215-11473237 AAAAGTCATTGCCATACCCAAGG + Intronic
1145048694 17:19641459-19641481 AAAAGTCATTGCCAAACCCAAGG - Intergenic
1149123364 17:53196982-53197004 AAAAGTCATTGCCAGACCCAGGG + Intergenic
1149132485 17:53321281-53321303 AAAAGTCATCACCATATCCAAGG - Intergenic
1149443547 17:56695889-56695911 AAAAGTCATCACCATACTCAAGG + Intergenic
1151333778 17:73427780-73427802 AAAAGTCATTGCCAAACCCAAGG - Intronic
1152940043 17:83164500-83164522 AAAAGTCATCACCTTACCCAAGG + Intergenic
1153751322 18:8233708-8233730 AAAAGTCATTGCCATATCCAAGG + Intronic
1154051178 18:10960463-10960485 AAAAGTCATTTATAGACACAGGG + Intronic
1154986131 18:21552893-21552915 AAATGTCATTGCCATACCCAAGG - Intronic
1156240820 18:35252259-35252281 AAAAGGCATGTATATACACAGGG + Exonic
1157644729 18:49256101-49256123 AAAAGTCATGTCTTTGGCAATGG + Intronic
1157652917 18:49354295-49354317 AAAAGTCATCACCATACCCAAGG - Intronic
1158276519 18:55774522-55774544 AAAATAAATGTCTATACCTAGGG + Intergenic
1158949546 18:62480432-62480454 GAAAGTCATGTGCATGCCCAGGG + Intergenic
1159177376 18:64855546-64855568 AAAACTCATCACTAAACCCAAGG + Intergenic
1164494866 19:28750411-28750433 ATAAGTAATGTTAATACCCAAGG - Intergenic
925784182 2:7412833-7412855 AAAAGTCATCACCAAACCCAAGG + Intergenic
926592502 2:14754585-14754607 AAAAGTCATCACCATACCCAAGG - Intergenic
927579990 2:24234428-24234450 AAGAGTCATCACTAAACCCAAGG - Intronic
928860433 2:35850718-35850740 AAAAGTCATCACTAAACCCAAGG + Intergenic
928909195 2:36401619-36401641 ATAAGTAATGTCAATACCAAAGG + Intronic
929767858 2:44864553-44864575 AAAAGTCACCACCATACCCAAGG - Intergenic
930331574 2:49992156-49992178 AAAAGTCAGTGCCATACCCAAGG - Intronic
930810951 2:55540190-55540212 AAAAGTCATCACCATACCCAAGG + Intronic
930940758 2:57011951-57011973 AAATGTCATCACTATATCCAAGG - Intergenic
930959674 2:57245292-57245314 AAATGTCATCACTATAACCAAGG + Intergenic
932458773 2:71868151-71868173 AAAAGTCATTACCATACTCAAGG + Intergenic
932470801 2:71954654-71954676 AAAATTCATCACCATACCCAAGG + Intergenic
932552631 2:72787163-72787185 AAAAGTCATCTCAATCCCCAGGG + Intronic
933043342 2:77499013-77499035 AAAAGACATTTCTACAGCCAAGG - Intronic
933736217 2:85496846-85496868 AAAAGTCTTGTGTGGACCCATGG + Intergenic
935047157 2:99492506-99492528 AGAAGTCATGTCCTTATCCATGG - Intergenic
935924634 2:108053695-108053717 AAAAGTCATTTCTTTTCCCTTGG + Intergenic
936575000 2:113645618-113645640 AAATGTCATGCACATACCCAGGG + Intergenic
936820030 2:116509271-116509293 AAAATTCATATCTGTACCAAGGG - Intergenic
937850675 2:126631813-126631835 AAAACTCATTCCTAAACCCAAGG - Intergenic
937959339 2:127443200-127443222 AAAAGTCATTGCCAAACCCAAGG + Intronic
939109463 2:137990146-137990168 AAAAGTCATCGCCGTACCCAAGG + Intronic
939191991 2:138927314-138927336 AAAAGTCATGTTTATTTCCTGGG - Intergenic
939297486 2:140287602-140287624 AAGATCCATGTCTAAACCCATGG - Intronic
940313092 2:152299474-152299496 AAAAGTCACCGCCATACCCAAGG + Intergenic
940425138 2:153522915-153522937 AAAAGTCATTGATAAACCCAAGG + Intergenic
940709574 2:157145301-157145323 AAAAGTCTAATTTATACCCAAGG - Intergenic
941401568 2:165037582-165037604 AAATGTGATTTATATACCCATGG - Intergenic
941402921 2:165053718-165053740 AAGAGTTATTACTATACCCAAGG - Intergenic
941741614 2:169041245-169041267 GAAAGTCACATGTATACCCAAGG + Intergenic
941837078 2:170035235-170035257 AAAAGTCATTGCCATACCCAAGG + Intronic
942404968 2:175644512-175644534 CAAAGTCATTTCCATACCCAAGG + Intergenic
942642930 2:178078873-178078895 AAGAGTCATGTCTTTCCTCAAGG + Intronic
942796705 2:179829495-179829517 AAAAGTCATATCCAAACCCAAGG - Intronic
943329148 2:186537966-186537988 AAAAGTTATTACCATACCCAAGG + Intergenic
943710476 2:191089018-191089040 AAAAGTCATCACTAAATCCAAGG - Intronic
943984720 2:194604599-194604621 AAGAGTCATGCCCATAACCATGG + Intergenic
944611299 2:201411059-201411081 AAACATCATGTCAATGCCCATGG + Intronic
944936192 2:204571218-204571240 AAGAGTCAGGGCTATCCCCAGGG - Intronic
944940134 2:204616051-204616073 AAAAGTCATTGCCATACTCAAGG - Intronic
945021447 2:205576357-205576379 AAAAGTCATCACCATGCCCAAGG + Intronic
945327801 2:208502843-208502865 AAAAGTCATCACCATACCCAAGG + Intronic
945392617 2:209282965-209282987 AAATGTCATCACTATACCCAAGG - Intergenic
945412932 2:209533661-209533683 AAAAGCCATGTTTATGCTCAAGG + Intronic
946993619 2:225364879-225364901 AAAAGCCAAGTTTTTACCCATGG + Intergenic
947756262 2:232567671-232567693 AAGAGTCAGCTCTATACACAAGG - Intronic
948533851 2:238631774-238631796 AAAAGTTATATTTCTACCCACGG - Intergenic
949076250 2:242060413-242060435 AAAAGTCAGCTCTACACCTATGG - Intergenic
1169649728 20:7853655-7853677 AAACCTCATGTCTATAAACAGGG + Intergenic
1169934479 20:10868312-10868334 AATAGTCATGTTTATACAAAGGG + Intergenic
1170636393 20:18108902-18108924 AAAAGTCATTGCCAAACCCAAGG + Intergenic
1170701122 20:18704574-18704596 AAAAGTTATCTCTAGAGCCATGG + Intronic
1172373952 20:34420721-34420743 AAAAACCATTTATATACCCAAGG - Intronic
1172616596 20:36291060-36291082 AAAAGTCATTACCATTCCCAAGG + Intergenic
1174784653 20:53421177-53421199 AAAAGTCATGGCCACAGCCACGG + Intronic
1177325678 21:19585561-19585583 AAAAGGCATGGCCATACCCTAGG + Intergenic
1178031468 21:28531362-28531384 AAAAGTCATCACCACACCCAAGG + Intergenic
1183569555 22:38642453-38642475 AAAAGTCATGGCCAAACCCAAGG - Intronic
1184945520 22:47801357-47801379 AAAAGTCATCACCACACCCAAGG - Intergenic
1185425174 22:50765257-50765279 AAATGTCATGCACATACCCAGGG - Intergenic
949146898 3:711916-711938 AAAAGTCATTGCAACACCCACGG + Intergenic
949196045 3:1309195-1309217 AAAACTCATCACTATATCCAAGG + Intronic
949983153 3:9516153-9516175 AAAAGTCATTGCCAAACCCAAGG + Intronic
950843490 3:15990376-15990398 AAAAGTCATTGCCATACCCAAGG + Intergenic
950845692 3:16013788-16013810 AAAAGTCATTGCCAAACCCAAGG + Intergenic
952156118 3:30645442-30645464 AGAAGTCATATCTATCCCAATGG - Intronic
952426183 3:33176656-33176678 AGAAGTCATTGCCATACCCAAGG + Intronic
952735524 3:36688074-36688096 AAAAGTCATCACCAAACCCAAGG - Intergenic
952917426 3:38258580-38258602 AAAAGTCATTACTATGCCCGAGG + Intergenic
953357719 3:42268436-42268458 AAAAATCATGACTATGGCCAAGG - Intergenic
953600067 3:44353982-44354004 AATAGTCATTTCTATCCCCAAGG + Intronic
953774182 3:45801473-45801495 AAAAGTCAGGTATGTACCCAGGG - Intergenic
953873911 3:46653482-46653504 AAAGGTCATTGCCATACCCAAGG - Intergenic
954485042 3:50840281-50840303 AAAAGTCATTGCTGTACTCAAGG + Intronic
954983127 3:54764202-54764224 AAAAATCCTGTCAAAACCCAAGG - Exonic
955590983 3:60534909-60534931 AAAAGTGATGTCTAAAACCAGGG - Intronic
957540195 3:81558628-81558650 ACAAGTCTTGTGTGTACCCAAGG + Intronic
957941111 3:87005151-87005173 TACAGTCATGTCTATATCCAGGG - Intergenic
958086772 3:88819351-88819373 AAAAGTCATTGCCATACCCAAGG + Intergenic
958443690 3:94188593-94188615 AAAAGTCATTGCCATAGCCAAGG + Intergenic
958447297 3:94231541-94231563 AAAAGTAATGACTATCTCCATGG - Intergenic
959436902 3:106326602-106326624 AAAAGTCATTGCCATACCCAAGG - Intergenic
959646404 3:108708206-108708228 AAAAGTCATCACCACACCCAAGG + Intergenic
962000649 3:131291981-131292003 AAAAGTCATTGCCATACTCAAGG + Intronic
962568147 3:136684947-136684969 AAAAGCCATCTCCAAACCCAGGG - Intronic
962718014 3:138144629-138144651 AAAAGTCATTGCCAAACCCAAGG - Intergenic
963232113 3:142918216-142918238 AAAAGTCAGTGCTAAACCCAAGG + Intergenic
963848939 3:150188708-150188730 AAAAATCATTACTATGCCCAAGG + Intergenic
964022505 3:152030533-152030555 AAAAGACATGTCTAAACCTCAGG - Intergenic
965289274 3:166857183-166857205 AAAAGTCATTGCCATACCAAAGG - Intergenic
966477160 3:180362693-180362715 AAAAGTCATTGCCATACCCAAGG + Intergenic
967911671 3:194547469-194547491 AAAAGTCATTGCCATGCCCAGGG + Intergenic
967953231 3:194856929-194856951 AAAAGCCATGTCAGTGCCCAGGG - Intergenic
968444186 4:640603-640625 AAAACTCATCACTAAACCCAAGG + Intronic
969109492 4:4834257-4834279 AAAAGTCATCACCAAACCCAAGG - Intergenic
969958601 4:10918895-10918917 AAAAGTCATCACTAAACCCTCGG - Intergenic
972203705 4:36746950-36746972 AAAAGTCATCACTATGCCCCAGG - Intergenic
973859576 4:55048618-55048640 AAAAGTCATCACTGTACCCAAGG - Intergenic
974475044 4:62367795-62367817 AAAAGTCATCACTATACACAAGG - Intergenic
974828901 4:67165563-67165585 AAAAGTCATTCCCACACCCAAGG - Intergenic
975652433 4:76607531-76607553 AAAACTCATGTCTTCATCCAGGG + Intronic
977155155 4:93562595-93562617 AAAAGTCATGGCAAAAGCCAAGG + Intronic
978126526 4:105142829-105142851 AAAATTATTGTCTAAACCCAGGG - Intergenic
978346055 4:107770973-107770995 AATAGTCATGTCCAAAACCAAGG - Intergenic
979647071 4:123082191-123082213 AATAGTCATTTCCATACCCAAGG + Intronic
979866117 4:125756086-125756108 AAAAATCATGTCTATCCTAAAGG - Intergenic
979952626 4:126913229-126913251 AAAAGTCATTGCCATGCCCAAGG - Intergenic
980484713 4:133440618-133440640 AACAGCCATGTGTATTCCCAGGG + Intergenic
980486073 4:133459436-133459458 AAAAGTGATGTATATATCCAAGG + Intergenic
982146482 4:152400363-152400385 AAAAGTCATGTCTATACCCAAGG - Intronic
982188577 4:152828783-152828805 AGAAGTCATCACCATACCCACGG + Intronic
982311321 4:153988356-153988378 AATAGTGATGTCTTTACCCCTGG + Intergenic
983246278 4:165291392-165291414 AAAAGTCATTGCCATACCCAAGG + Intronic
984130335 4:175867314-175867336 AAAAGTCATCACCATACCCAAGG + Intronic
984754099 4:183309164-183309186 AAAAGTCACTGCCATACCCAAGG - Intronic
985759614 5:1739170-1739192 AAAAGCCATTGCTATACCCAAGG + Intergenic
986099164 5:4590108-4590130 GAAGTTCATGTCTTTACCCAAGG + Intergenic
987114707 5:14717026-14717048 ATTAGCCATGTCTGTACCCAGGG + Intronic
987273130 5:16333858-16333880 AAAAGTCATTGCCTTACCCAAGG - Intergenic
987849286 5:23328533-23328555 AAAAGTCATACATATAACCATGG - Intergenic
988244598 5:28663360-28663382 AAAAATCATCCCCATACCCAAGG - Intergenic
990094586 5:52096301-52096323 AAAAGTCATCGCCATGCCCAGGG + Intergenic
990473264 5:56137615-56137637 AAAAGTCATCACCAAACCCAAGG - Intronic
991119120 5:62990563-62990585 AAAAGTCATTGCCATACCCAAGG + Intergenic
991619124 5:68526923-68526945 AAAAGTCATTGCCAAACCCAAGG + Intergenic
991626410 5:68605818-68605840 AAAAGTCATGTTAATACCCAGGG + Intergenic
991690621 5:69221693-69221715 AAAAGTCATTCCTAAACCTAAGG - Intronic
992055252 5:72982607-72982629 AAAAGTCATCACCATAGCCAAGG + Intronic
992158173 5:73975098-73975120 AGAAGTCATGTCTAGACTCTTGG - Intergenic
992544760 5:77801908-77801930 AAAAGTCAACACTATGCCCAAGG - Intronic
992601027 5:78399850-78399872 AAAAGTCATCACCATACCCAAGG + Intronic
992934076 5:81683561-81683583 AAAAGTCATTGCCATATCCAAGG - Intronic
993935804 5:94000713-94000735 AAAAGTCATTAACATACCCAAGG + Intronic
995637981 5:114217681-114217703 AAAAGCCATGACCACACCCAAGG - Intergenic
996504239 5:124251622-124251644 AAAAGTCATCACCATTCCCATGG - Intergenic
997019414 5:129980680-129980702 AAAGGTCATCACCATACCCAAGG + Intronic
997184599 5:131869040-131869062 AAAAGTCATCACCATACTCAAGG + Intronic
997749905 5:136334277-136334299 AAAAGTCACTTCTATACATATGG - Intronic
998532025 5:142894190-142894212 AAAAATCAAGTCACTACCCAAGG - Intronic
998558721 5:143150852-143150874 AAAAGTCATAATTATACCCAAGG - Intronic
998962164 5:147500103-147500125 AAACGTCATCACTATACCCAAGG - Intronic
999427726 5:151501938-151501960 AAAACTCATTGCTAAACCCAAGG - Intergenic
1000471609 5:161649357-161649379 AAATGTCATTTCAATACCCAAGG + Intronic
1000913801 5:167055088-167055110 AAAAGTCATCGCCATACTCAAGG + Intergenic
1001418940 5:171572292-171572314 ACAAGGCATGTCCATGCCCATGG + Intergenic
1001968144 5:175929019-175929041 AAAAGTCATTGCCAAACCCAGGG - Intronic
1002249299 5:177914791-177914813 AAAAGTCATTGCCAAACCCAGGG + Intergenic
1003504861 6:6732192-6732214 AAAAGTCATTCCCAAACCCAGGG - Intergenic
1003761392 6:9182249-9182271 AAAATTCATGTTGAAACCCAAGG - Intergenic
1003854375 6:10257942-10257964 AAAAGTCATCACCATACCTAAGG - Intergenic
1004284028 6:14303902-14303924 AAAAGTCATGTCTAAGCCCAAGG + Intergenic
1004923321 6:20397255-20397277 CAGAGTCATGTGTATACCCTTGG - Intergenic
1005727950 6:28668226-28668248 AAAAGTCCTGTCTGGACCCAAGG + Intergenic
1006111065 6:31745618-31745640 AAAACTCTTCTCTATACACAAGG - Intronic
1006825546 6:36932405-36932427 AAAGGTCACCTCTATAACCAAGG + Intergenic
1007456622 6:41983023-41983045 AAAAGTCATCACTCTACCCAAGG - Intronic
1008118644 6:47584276-47584298 AAAAGTCATTGCCATACCCAAGG + Intronic
1008392196 6:50965215-50965237 AAATGTCATTCCAATACCCAAGG + Intergenic
1008639938 6:53451779-53451801 AAAAGTCATTGCTAAACCAAAGG + Intergenic
1008713370 6:54256880-54256902 ACAAGTCATGTTCAGACCCACGG - Intronic
1011105610 6:83776898-83776920 AAAAGTCATTTCTGTACGCAAGG - Intergenic
1011963541 6:93122547-93122569 AAAAGTCATCACTATACTCAAGG + Intergenic
1012006775 6:93722455-93722477 AAAAGAGATTTCTATACCCCAGG + Intergenic
1012140291 6:95618450-95618472 AAAAGGCATCTCTATGACCATGG + Intergenic
1012378963 6:98597187-98597209 AAAAGCCATTGCCATACCCAAGG - Intergenic
1012385504 6:98677218-98677240 AAAAGTCATTGCCATACCCAAGG - Intergenic
1012925920 6:105267633-105267655 AAAAGTAATCTCTATCCCCAAGG - Intergenic
1013306871 6:108856114-108856136 AAAAGTCATCGCAATACGCAAGG + Intronic
1013331252 6:109102551-109102573 AAAAGTCATTGCCATACCCAGGG + Intronic
1014106536 6:117570561-117570583 AACAGCCACGTCTATTCCCAAGG + Intronic
1014264958 6:119266670-119266692 AAAAGTCATCTCCAAACCCAGGG - Intronic
1014568401 6:122978751-122978773 AAAAGTGATGTGTAAACCAAAGG - Intergenic
1016601712 6:145869400-145869422 AAAAGTCATTGCCAAACCCAAGG + Intronic
1017246030 6:152226052-152226074 AAAAGTCATCTTTTTACACATGG + Intronic
1018236793 6:161734264-161734286 AAAAATCATGTTTCAACCCACGG + Intronic
1018263987 6:162000712-162000734 AAAAGTTATTACTATACCTAAGG + Intronic
1018558047 6:165070142-165070164 AAAAGTAATCACCATACCCAAGG - Intergenic
1018786196 6:167109864-167109886 AAATGTGCTGTCTATACCCGTGG - Intergenic
1018863319 6:167728680-167728702 AAAAGTCATTGCCAAACCCAAGG - Intergenic
1019092293 6:169548984-169549006 AAAATTCATTGCCATACCCAAGG - Intronic
1019235831 6:170611610-170611632 AAAACTCATGGCCAAACCCAAGG - Intergenic
1020442100 7:8228364-8228386 AAATGGCATGTCCATATCCATGG + Intronic
1020566553 7:9804493-9804515 AAAAGTCATCGTCATACCCATGG - Intergenic
1021506441 7:21390602-21390624 AAATGTCATCACCATACCCAAGG + Intergenic
1022125218 7:27349696-27349718 GAAAGTTATGTCTGGACCCAGGG - Intergenic
1022420706 7:30220339-30220361 AAAAGTCATCACCAAACCCAAGG - Intergenic
1022437602 7:30404760-30404782 AATAGTCATGTGTATACTGAAGG - Intronic
1022899857 7:34796263-34796285 AAAAGTCATCACCATACTCAAGG - Intronic
1024108466 7:46118477-46118499 AAAACTCATCTCTAAACCCAAGG + Intergenic
1024571340 7:50725125-50725147 AAATCTCATGTCCATCCCCAAGG + Intronic
1026175908 7:67996597-67996619 AGAGGGCATCTCTATACCCAAGG - Intergenic
1026599427 7:71763986-71764008 AAAAGTCACTGCTAAACCCAAGG + Intergenic
1028268158 7:88754290-88754312 AAAAGTCATTACCAGACCCAAGG - Intergenic
1030019839 7:105262581-105262603 AAAACTAATGTTAATACCCACGG + Intronic
1030291469 7:107876961-107876983 AAAAGTTATTGCTATATCCAAGG - Intergenic
1030769398 7:113455695-113455717 AAAAGTCATTGCCATTCCCAAGG - Intergenic
1030834905 7:114270870-114270892 AAAAATCATCACTATACCTAAGG + Intronic
1032178556 7:129654523-129654545 AAAAGTCATTGCCATACCCAAGG + Intronic
1035304264 7:157920839-157920861 AAAAGTCATCACCAAACCCAAGG - Intronic
1035340997 7:158161660-158161682 AAAAGTCATCACCAAACCCAAGG - Intronic
1035552576 8:541343-541365 AAAAGCCATCACTGTACCCAAGG - Intronic
1035932078 8:3791491-3791513 AAAAGTCATCTCTACAACAAGGG + Intronic
1036686070 8:10911146-10911168 AAAATCCATGTTTTTACCCACGG - Intronic
1037016901 8:13918885-13918907 AAAATTCATCACCATACCCAAGG + Intergenic
1037254696 8:16940512-16940534 AAAAGTCATCACTATACCCAAGG - Intergenic
1039698483 8:39938519-39938541 AAAAGTTATCTCCAAACCCAAGG - Intronic
1039722322 8:40177403-40177425 AATACTCATGTTCATACCCATGG + Intergenic
1039924960 8:41921410-41921432 AAAAGTCATTGCTATACCCAAGG - Intergenic
1040690070 8:49926670-49926692 AAAAGTCATTGCCATACCAAAGG - Intronic
1040746356 8:50647141-50647163 AGAAGTCATCACCATACCCAAGG - Intronic
1041317215 8:56576621-56576643 AAAAGTTATCTCTATATCTAAGG + Intergenic
1041804488 8:61835062-61835084 AATAGCCATGTCTATGCCCAAGG - Intergenic
1041951124 8:63503886-63503908 AAAAGTCATCACCATACCGAAGG + Intergenic
1042292452 8:67183751-67183773 AAAAGTCATCACCATATCCAAGG - Intronic
1042292858 8:67187958-67187980 AAAAGTCATCACCATACCCAAGG - Intronic
1042558730 8:70056330-70056352 AAAAGTGATGTCAAAACCAAAGG - Intronic
1043066810 8:75582738-75582760 AAAAGTCATTGCCATATCCAAGG - Intergenic
1043234726 8:77848862-77848884 AAAATTCATCACTATACCCAAGG + Intergenic
1043494443 8:80784803-80784825 AAAGGTCATCACCATACCCAAGG + Intronic
1044606081 8:94048859-94048881 AAAAGTCATCTCCATACCCAAGG + Intergenic
1044789354 8:95831555-95831577 AAAAGCCATCACCATACCCAAGG - Intergenic
1044864965 8:96562055-96562077 AAAAGTCATCGCCATACTCAAGG + Intronic
1047205599 8:122800728-122800750 AAAAGCCATGTATTTTCCCAAGG + Intronic
1047672863 8:127167533-127167555 AAAAATTATCACTATACCCAAGG + Intergenic
1048191069 8:132289663-132289685 AAAATCCATGTCTTTACCCATGG - Intronic
1048908451 8:139111127-139111149 GAAACTCTTGTCCATACCCATGG + Intergenic
1050501501 9:6302937-6302959 AAAAGTTATGTGTATATCCTGGG + Intergenic
1051178243 9:14382736-14382758 AAAAGTCATATATTCACCCAAGG + Intronic
1051442361 9:17099078-17099100 AAAAGTCTTCACCATACCCAAGG + Intergenic
1051577459 9:18633260-18633282 AAAAGTCATGTCTTTATGCAAGG + Intronic
1052665505 9:31489907-31489929 AAAATTCATCTCCATACCCAAGG + Intergenic
1052956809 9:34258823-34258845 AAATGACTTGTCTATTCCCAGGG + Intronic
1053040955 9:34871501-34871523 AAAAGTCATCATCATACCCAAGG + Intergenic
1054459019 9:65452459-65452481 AAAAGAAATGTTTAAACCCAAGG - Intergenic
1055015381 9:71611870-71611892 AAAAGTTATGGCCATATCCAAGG - Intergenic
1055340575 9:75277686-75277708 AAAAGTCATGACCAAACTCAAGG + Intergenic
1055448447 9:76407054-76407076 AAAAGTCATTCCCATACACAAGG + Intergenic
1056004492 9:82253870-82253892 AAAAGTCATTGCCAAACCCAGGG + Intergenic
1056192860 9:84201823-84201845 AAAAGTTATCACTATACTCAAGG - Intergenic
1056561842 9:87737122-87737144 AAAAGCCATCGCCATACCCAAGG - Intergenic
1056702643 9:88923905-88923927 AAATGACATGGCTATACCAAGGG + Intergenic
1056844797 9:90028085-90028107 AAAAGTCATCACCATACCCAAGG - Intergenic
1057754907 9:97825584-97825606 AAAAGTCATTGCCAAACCCAAGG - Intergenic
1057840151 9:98479740-98479762 AAATTGCATGTCTACACCCAGGG - Intronic
1058224567 9:102343968-102343990 AAAATTCATCTCTAACCCCAAGG + Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1062079006 9:134609552-134609574 AAGAGTCACTGCTATACCCAAGG + Intergenic
1187792021 X:22961300-22961322 AAAATTCATCTGTATACCTATGG + Intergenic
1188428702 X:30080158-30080180 AAAAGTCATCACTATACCCAAGG + Intergenic
1188997440 X:36903526-36903548 AAAAGTGGTGTATATACACATGG - Intergenic
1189934250 X:46050467-46050489 AAAAGTCATCACCAAACCCAAGG - Intergenic
1190617771 X:52254236-52254258 AAAAGTCATCACCAAACCCAAGG + Intergenic
1190724386 X:53178699-53178721 AAAAGTTATTGCCATACCCAAGG - Intergenic
1190870046 X:54417057-54417079 AAAAGTCTTGTAGATCCCCAAGG - Intergenic
1192771488 X:74196114-74196136 AAAAGTCATTGCTAAACCCTAGG - Intergenic
1194018323 X:88654977-88654999 AAAAATCATTGCTATAACCAGGG - Intergenic
1194184379 X:90755396-90755418 AAAAGTCATCACCATACCCAAGG - Intergenic
1194632944 X:96308857-96308879 AAAAGTCATTGCCAAACCCAAGG - Intergenic
1194891058 X:99379486-99379508 AAAAGTCATTGCTAAATCCAAGG + Intergenic
1195898169 X:109769895-109769917 AAAAGTCATCACCATACCCAAGG - Intergenic
1195906538 X:109850032-109850054 AAAAGTAATGTCATTACCCTTGG - Intergenic
1196027991 X:111062823-111062845 AAAAGTAATTTCCTTACCCATGG - Intronic
1196249146 X:113437968-113437990 AAAAGTCATTGTCATACCCAAGG + Intergenic
1196767268 X:119258450-119258472 AAAAGTCATTGCAATACGCAAGG - Intergenic
1196949728 X:120865291-120865313 AAAAGCCATGTCCAAACCCAAGG + Intergenic
1197948376 X:131865583-131865605 AAAAGTCATCTCCAAACCAAAGG + Intergenic
1198789281 X:140325432-140325454 AAAAGTCATCACCAAACCCAAGG - Intergenic
1200530970 Y:4337309-4337331 AAAAGTCATCACCATACCCAAGG - Intergenic
1200966221 Y:9041301-9041323 AAAACTCATGACCAAACCCAAGG + Intergenic
1200968459 Y:9124505-9124527 AAAACTCATGACCAAACCCAAGG + Intergenic
1202142306 Y:21737710-21737732 AAAACTCATGACCAAACCCAAGG - Intergenic
1202144559 Y:21766092-21766114 AAAACTCATGACCAAACCCAAGG + Intergenic
1202147200 Y:21810860-21810882 AAAACTCATGACCAAACCCAAGG - Intergenic