ID: 982147745

View in Genome Browser
Species Human (GRCh38)
Location 4:152415907-152415929
Sequence GGGTATTATTTTAAGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982147745 Original CRISPR GGGTATTATTTTAAGTTGGA TGG (reversed) Intronic
902728089 1:18350648-18350670 GGGTATTTTTTTTTGTGGGAGGG - Intronic
903074242 1:20750105-20750127 GGCTATTATTTTAGGGTGGATGG - Intronic
903149551 1:21396832-21396854 GGGTTTTAGTTTAAATTGTAAGG + Intergenic
904066387 1:27755154-27755176 GGAAAATATTTTAACTTGGATGG - Intronic
906181468 1:43823534-43823556 GGCTATGATTTTAAATGGGATGG - Intronic
907486708 1:54782939-54782961 GAGGATTATTTTAGGTAGGATGG + Intronic
909308841 1:74119693-74119715 GAGTATTATTTTAATTTGGTGGG - Intronic
910964783 1:92797337-92797359 GGTTTTTATTCTAAATTGGATGG + Intergenic
911540153 1:99147660-99147682 GGGTAGTCTTTAGAGTTGGAGGG - Intergenic
911866013 1:103022995-103023017 GGCTATTAATTTAAATTGCAAGG + Exonic
913356271 1:117925845-117925867 GTGAATGATTTTGAGTTGGAGGG - Intronic
914776223 1:150738044-150738066 GGGTTTTATTCTGAGTGGGAAGG + Intronic
915993082 1:160536979-160537001 TGGTATTGGTTAAAGTTGGATGG + Intergenic
916665402 1:166962504-166962526 AGGTATTTTTTGAAGTTGGATGG - Intronic
916781696 1:168038225-168038247 GGGTTTCATTTAAAGTTTGAAGG - Intronic
919113616 1:193252627-193252649 GGGTCTGATTTTAAGATAGATGG - Exonic
921145836 1:212355281-212355303 GGGTTTTTTTTTAAGTTTTAAGG + Intronic
921980247 1:221249057-221249079 GGGTATAATTTTAAATAGGTTGG - Intergenic
922427730 1:225514947-225514969 TGATATTATTTTATGTGGGAAGG + Intronic
922672057 1:227517636-227517658 GGGCAGTATTTTTAGTTGGTAGG + Intergenic
924021462 1:239788227-239788249 TGGTATTATTTTGAGTTGGGGGG - Intronic
1064908377 10:20371870-20371892 GATTTTTATTTTAAGTTAGAAGG + Intergenic
1065344510 10:24736022-24736044 TGGTGCTATTTTAAGTAGGATGG - Intergenic
1065403390 10:25332696-25332718 GCTTATTATTTAAAGTTAGAGGG - Intronic
1067391500 10:45867037-45867059 GATTATTTTTTTAAGTTGAATGG - Intergenic
1067403183 10:45996630-45996652 GATTATTTTTTTAAGTTGAATGG + Intronic
1067492078 10:46718504-46718526 TGCTATTATTTTAAGGAGGAAGG + Intergenic
1067602585 10:47621880-47621902 CGCTATTATTTTAAGGAGGAAGG - Intergenic
1067871789 10:49969102-49969124 GATTATTTTTTTAAGTTGAATGG + Intronic
1068420825 10:56790078-56790100 GGATTTTGTTTTAATTTGGAGGG - Intergenic
1069438788 10:68409054-68409076 GGCTTTTATTTTAGGTTTGAGGG + Intergenic
1071472075 10:85990743-85990765 GGGTTTTATTTTAAGTTGAATGG + Intronic
1071487617 10:86113216-86113238 GGGTTCTATTTTAAGTGTGATGG - Intronic
1071653938 10:87427290-87427312 TGCTATTATTTTAAGGAGGAAGG - Intergenic
1071940685 10:90588252-90588274 GGATTTTATTTTAAGTGTGATGG - Intergenic
1071965609 10:90849085-90849107 GTGTATTATTTCAAGTTTTAAGG + Intronic
1072132204 10:92505652-92505674 GGGCATTATTTTAGATTGGGAGG + Intronic
1072564615 10:96607210-96607232 GGGAATTATTTCTATTTGGAAGG + Intronic
1073075395 10:100822815-100822837 GGTGATAATCTTAAGTTGGATGG + Intronic
1073367825 10:102958346-102958368 GAATATGATTTGAAGTTGGACGG + Intronic
1074175519 10:110997535-110997557 AGGTATGATGTTAAGTTGGGGGG - Intronic
1076030929 10:127157407-127157429 GGGCATTATTTTAAATTGAATGG + Intronic
1077715397 11:4575340-4575362 GGGGAATATTTTGAGTTGGCAGG + Intronic
1077977803 11:7266302-7266324 GTGTATTACTTTAATTTTGAGGG + Intronic
1079489118 11:20967822-20967844 GGGTATTATTCTAAGAGGCATGG - Intronic
1079608547 11:22401067-22401089 GGATTTTATTTTAAGTTCAATGG + Intergenic
1082278216 11:50244291-50244313 AGATAATATTTCAAGTTGGACGG + Intergenic
1085220479 11:74870078-74870100 TGGTTTTATTTTAAAATGGAGGG - Intronic
1085420733 11:76356735-76356757 AGGTATTATTTGAAAATGGATGG + Intronic
1086977499 11:93152372-93152394 GGCTTTTACTTTAATTTGGAAGG + Intronic
1087612484 11:100451554-100451576 GGGTATAGTTTTAAGTAGGGTGG + Intergenic
1088100795 11:106153656-106153678 GGGAATTAATTTCAGTTGCAAGG - Intergenic
1090368063 11:126224590-126224612 GGGTATAATTTTAAATAGAATGG + Intronic
1091265778 11:134270080-134270102 GGGGTTTATTTTCAGTTGGAAGG - Intergenic
1092548503 12:9472346-9472368 GGGTTTTACTTTGAGTGGGATGG - Intergenic
1093053803 12:14534417-14534439 TAGTTTTATCTTAAGTTGGAGGG + Intronic
1094264261 12:28538117-28538139 GGGTTTTTTTTTAAGTTTTAGGG + Intronic
1094504503 12:31050103-31050125 GGGTTTTACTTTGAGTGGGATGG + Intergenic
1095912360 12:47441609-47441631 AGGAATTATCTTAAGATGGAGGG - Intergenic
1097314522 12:58157704-58157726 TGGAGTTATTTTAAGTGGGAAGG + Intergenic
1097930157 12:65174711-65174733 CGGTATTATTTTAAGCAGCAGGG + Intronic
1098214904 12:68205334-68205356 GGCTATTAGTTTAATTTGGGGGG - Intronic
1099158000 12:79203642-79203664 GGGTTTTATCTTAAATTGAAAGG + Intronic
1099579885 12:84431768-84431790 AGGTATAATATTAAATTGGATGG + Intergenic
1099679183 12:85802967-85802989 AGGTCTTATTTCAAGTTGGCTGG - Exonic
1099701236 12:86085003-86085025 GGGTTTTATTCTAAGTTATAAGG + Intronic
1100491448 12:95082848-95082870 CGGTATTATTTTATGTAGGCTGG + Intronic
1100741289 12:97596297-97596319 AGGTATTCTGTTAAGTTAGAGGG + Intergenic
1100794838 12:98170972-98170994 GAGGATTCTTTTAAGTTTGATGG - Intergenic
1101800140 12:108014589-108014611 GGGTTTTATTCTCAGTAGGATGG + Intergenic
1104132552 12:125908502-125908524 TGGTATTATTTTATGTCCGATGG + Intergenic
1106324034 13:28670553-28670575 GGGTTTTATTTTTATTTAGAGGG - Intronic
1106458661 13:29949133-29949155 GGGTGTTATTTTCAGTTGCTGGG + Intergenic
1106466780 13:30020874-30020896 TGGAATTATTTTAAACTGGAAGG + Intergenic
1106741550 13:32648495-32648517 TATTATTATTTTTAGTTGGAGGG + Intronic
1106963557 13:35031801-35031823 GGGTTCTATTTGAAGGTGGAGGG - Intronic
1107113145 13:36719307-36719329 GTGTGTTATTTTAAGTGAGATGG - Intergenic
1109926935 13:69155035-69155057 GGATATTATTTTAAGTAAGTTGG - Intergenic
1111606299 13:90544001-90544023 GGGGCCTATTTGAAGTTGGATGG + Intergenic
1111727961 13:92036915-92036937 CTATAGTATTTTAAGTTGGAGGG - Intronic
1111927565 13:94479381-94479403 GGGTATTTTTTTAAGAAGAAAGG - Exonic
1116591295 14:46778365-46778387 GGTTACTATATTAAGTAGGAAGG - Intergenic
1117574282 14:57082619-57082641 GGGTATCATTTTATTTGGGAAGG - Intergenic
1117933242 14:60870342-60870364 GGGTATTACCTAAAGTTGCATGG + Intronic
1118031556 14:61822952-61822974 GGGTATTACTTAAAGTTTTAAGG + Intergenic
1119105801 14:71922480-71922502 GGGTGTTATTTTAGGTGTGAGGG - Intergenic
1120096481 14:80394524-80394546 GGGAATTTTTATAAGGTGGAAGG - Intergenic
1124201550 15:27682530-27682552 AGGTAGTATTTTACTTTGGATGG - Intergenic
1124555592 15:30722365-30722387 GGGTATTATAGAAAGTTGGGTGG + Intronic
1127399426 15:58571623-58571645 GTGGATTATTTTCACTTGGAGGG + Intergenic
1129101250 15:73266171-73266193 GGGGATTATTTCAGGTTGTAGGG - Intronic
1129191283 15:73939139-73939161 GGGGATTATGTGATGTTGGAAGG - Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131439298 15:92446962-92446984 GGGTTTGATTCTAAGTTTGAGGG + Intronic
1131518058 15:93092468-93092490 TGGGATTATTTCTAGTTGGAAGG + Intergenic
1131982387 15:98006587-98006609 GCCTATAATTTTAAGTTAGATGG + Intergenic
1133017156 16:2949347-2949369 GGGGTTTAATTTAACTTGGAAGG - Exonic
1133144625 16:3775381-3775403 GAGTATTATTGGAAATTGGAAGG - Intronic
1134811701 16:17172823-17172845 GGGTATCACTTTGAGTTGTATGG + Intronic
1137234670 16:46605669-46605691 GGGTATTTTTTTAAGTTCCCTGG + Intronic
1137875454 16:51992561-51992583 GGGCTTTATTTTAAGTATGATGG + Intergenic
1139156385 16:64447797-64447819 GGTTATTATTTTAGGTGGGAAGG + Intergenic
1142990857 17:3729891-3729913 GGCTATTTTTTTAAGTTCCAGGG + Intronic
1149513361 17:57260491-57260513 GGGTGTTTTTTTTAGTTGGCCGG - Intronic
1149738988 17:59025335-59025357 GGGTCTTATTTTTATTTGGAAGG - Intronic
1156179848 18:34590132-34590154 GGGTATATTTTTAAGTTGATTGG + Intronic
1158338305 18:56437191-56437213 AGTTATAATTTTAAATTGGAAGG - Intergenic
1158365339 18:56727955-56727977 AGGAATTATTTTAAATTGAAAGG - Intronic
1158736235 18:60084482-60084504 GGGTATTATTCTAACTTGCGTGG + Intergenic
1159444931 18:68530307-68530329 AGGTATTATTCTAAGTCAGAAGG + Intergenic
1163687254 19:18718877-18718899 GGGGTTTATTTTAAATAGGATGG + Intronic
1164264633 19:23602899-23602921 GGCTTTTATTTTAAGCTTGAGGG - Intronic
925246063 2:2384255-2384277 GGGTATAATTTTAAATAGGGTGG - Intergenic
925395491 2:3530397-3530419 GAGTATTATTATTAGTAGGATGG + Intergenic
925395497 2:3530434-3530456 GAGTATTATTATTAGTAGGAGGG + Intergenic
925395527 2:3530679-3530701 GAGTATTATTATTAGTAGGATGG + Intergenic
925395533 2:3530716-3530738 GAGTATTATTATTAGTAGGAGGG + Intergenic
925395538 2:3530785-3530807 GAGTATTATTATTAGTAGGATGG + Intergenic
925395555 2:3530951-3530973 GAGTATTATTATTAGTAGGATGG + Intergenic
925395568 2:3531057-3531079 GAGTATTATTATTAGTAGGATGG + Intergenic
925395574 2:3531094-3531116 GAGTATTATTATTAGTAGGAGGG + Intergenic
925455535 2:4013582-4013604 GGGAGTTATTTTAATTTGGGTGG + Intergenic
925815545 2:7744476-7744498 GGGTATAACTTTAAATCGGAGGG + Intergenic
925887918 2:8409630-8409652 GGGTAATATTTTCAGTGGAAAGG - Intergenic
926991846 2:18688772-18688794 GAGCATTACTTTAAGTAGGAAGG - Intergenic
927320228 2:21735186-21735208 GGGTATTCTTTAAAGTTGCGGGG - Intergenic
927350213 2:22103146-22103168 TGGTATTATTTTAAATTAGAAGG + Intergenic
930315112 2:49787780-49787802 GGGGACTATTTGAAGTAGGATGG + Intergenic
939373808 2:141337971-141337993 GGGTCTTATTTTAAGTTCTATGG + Intronic
939576955 2:143907558-143907580 GTCTATTATTTTAAGGAGGATGG - Intergenic
940514271 2:154660398-154660420 GGTGATTATTCTTAGTTGGAAGG - Intergenic
941442096 2:165551168-165551190 GGGTATTAGTTTGAGTTAGCAGG - Intronic
942734437 2:179093701-179093723 TGATATTATTTTAATTTTGAGGG + Intergenic
943892961 2:193314413-193314435 AGGTATTATTTTTAGTAGAAGGG + Intergenic
945128856 2:206544431-206544453 GGGTATTATTTTAGGTTCTGGGG + Intronic
945802898 2:214455662-214455684 GGGGATTATCTTATGTTGGTTGG - Intronic
946664812 2:222037446-222037468 GGGTTTTATTCTAAGTGTGATGG - Intergenic
947106134 2:226669767-226669789 GGGTATTATTTTAAGAAGCTCGG - Intergenic
947141123 2:227020203-227020225 AGTTATTTTTTTAAGTTGGAGGG + Intronic
948338756 2:237232172-237232194 TGCTTTTATTTTAAGTTGCAAGG + Intergenic
948399140 2:237670373-237670395 GGCTGTGATTTTAAGATGGAGGG + Intronic
1170002045 20:11625597-11625619 GGTTAGTATTTTAAGTTTGAGGG - Intergenic
1174435710 20:50505288-50505310 GGGTTTTCTTCTAAGTAGGATGG + Intergenic
1174829610 20:53800579-53800601 GGATTTTATTTTAAGTGGGAGGG - Intergenic
1177202092 21:17968761-17968783 GGGTATTTCTCTTAGTTGGATGG + Intronic
1178623627 21:34197913-34197935 GGAAAATACTTTAAGTTGGATGG - Intergenic
1181389026 22:22565778-22565800 GGGTGTTATTTTAAGGTGCTAGG - Exonic
1181877224 22:25949094-25949116 GGGTTTTATTTTATGGTTGAAGG + Intronic
951163621 3:19457851-19457873 GTGTATTATTTTATCTTGGTTGG + Intronic
951927036 3:27919578-27919600 GGATTTTATTTTAAGTATGAAGG + Intergenic
953204116 3:40806015-40806037 AGTTATTATTTTATGTTTGATGG - Intergenic
953743551 3:45556490-45556512 GGGTGGTATTTTATGTAGGATGG - Intronic
957507642 3:81144756-81144778 GTTTATGATTTTCAGTTGGATGG - Intergenic
958463123 3:94424240-94424262 GGGAATTACTTGAAGGTGGAGGG + Intergenic
958535390 3:95397239-95397261 AGGTATTATTTTATGTGGAAAGG - Intergenic
963179161 3:142335901-142335923 CGGTATTATATTAAGTTGGTAGG + Intronic
963549174 3:146698934-146698956 GGCGATTATTTTAAGATGGCAGG + Intergenic
964999591 3:162936260-162936282 GTGTATTGTTCTAAGATGGAGGG + Intergenic
970036482 4:11741388-11741410 AGGTATTTTTTTGAGTTGGAAGG + Intergenic
970343164 4:15127952-15127974 GGGCATTATTTTAAGCAGAATGG - Intergenic
970883980 4:20965458-20965480 GGGAAATTTTTTAAGTGGGAAGG - Intronic
971805248 4:31350369-31350391 GGGTATTATTTGCAGTAAGAAGG + Intergenic
971899702 4:32643651-32643673 AGCTATTATTTTAAGTTCGGGGG - Intergenic
972672116 4:41222646-41222668 GAGTATTTTTTCAGGTTGGATGG - Intergenic
972709707 4:41582821-41582843 CAGTATTTTTATAAGTTGGAGGG + Intronic
972803551 4:42504114-42504136 TGGAATTATTTTAAATAGGATGG - Intronic
972941999 4:44207334-44207356 GGGTATGATTTAAAATAGGATGG - Intronic
973804529 4:54513050-54513072 GGGGATTACTTTAGATTGGATGG + Intergenic
974387273 4:61218029-61218051 GGTTATTATTTAAATTTGGGGGG + Intronic
975904259 4:79190674-79190696 AGTTATTATTTTAGGTTTGAGGG + Intergenic
976416537 4:84782781-84782803 GGTTATTATTTTAAATTGACTGG + Intronic
977419500 4:96780160-96780182 GGGTTATATTTTAGTTTGGAAGG - Intergenic
977585162 4:98767674-98767696 GTGTGTTCTTTTCAGTTGGATGG + Intergenic
978440906 4:108732274-108732296 GGTTCTTATTTGAAGTGGGAAGG - Intergenic
978940651 4:114432512-114432534 GGGTATCATTGTATGTGGGACGG + Intergenic
982147745 4:152415907-152415929 GGGTATTATTTTAAGTTGGATGG - Intronic
982168913 4:152642294-152642316 GGGTATTTTTTTAAGATAAATGG + Intronic
982885825 4:160781836-160781858 AGGTTTTATGTTAAGTTGGTAGG + Intergenic
983578849 4:169287861-169287883 AGGTTTTACTTTAGGTTGGATGG - Intergenic
983936460 4:173506243-173506265 GGGCACTATTTTAAGCTGTAGGG - Intergenic
984004432 4:174292123-174292145 GGTAATTATTTTCAGTTGGCAGG + Intronic
984201206 4:176723463-176723485 GGGTTTTATTTTAGGTTTGGGGG + Intronic
984201221 4:176723552-176723574 GGGTTTTATTTTAGGTTTGGGGG + Intronic
984201250 4:176723771-176723793 GGGTTTTATTTTAGGTTTGGGGG + Intronic
984201260 4:176723836-176723858 GGGTTTTATTTTAGGTTTGGGGG + Intronic
985026006 4:185740088-185740110 GGGTATTATTTCTGGTTTGAGGG - Intronic
987186384 5:15424462-15424484 GGGTATTAATAAAAGTTTGAAGG - Intergenic
987212425 5:15696367-15696389 GAGGATTATTTTGAATTGGAAGG + Intronic
987871113 5:23618017-23618039 GGGAAATATTTAAAGTAGGAAGG - Intergenic
991724448 5:69522215-69522237 GGGTATTATTTAAACCTTGAAGG - Intronic
993231044 5:85236579-85236601 GGGTTTTATTTTGCTTTGGATGG + Intergenic
994554829 5:101286052-101286074 GGTTATAATTTTAAGTAGAAAGG + Intergenic
994758486 5:103824082-103824104 CGGTATTATTTAAGTTTGGATGG + Intergenic
995008376 5:107229323-107229345 GAGTATTATTTTAAGTTTTATGG - Intergenic
995247057 5:109946346-109946368 GGATATTATTTTAAGTTTGTTGG + Intergenic
996278874 5:121702841-121702863 TGGTATGAATTTTAGTTGGAAGG - Intergenic
998109941 5:139493541-139493563 TGTTATTATTTTAAGTTGCATGG - Intergenic
999482091 5:151958122-151958144 TGGTGTTATTTTAAGATGGGTGG - Intergenic
999939525 5:156526613-156526635 GGATATTATTAAAAATTGGAAGG + Intronic
1001341010 5:170845441-170845463 GAGTGTTGTGTTAAGTTGGATGG - Intergenic
1001820492 5:174706401-174706423 AGGTTTTATTCTAAATTGGAGGG - Intergenic
1003900675 6:10652541-10652563 GGGTATGATTTTAAGAAAGATGG - Intergenic
1004025088 6:11810436-11810458 TGCTATTATTTTTAGTTGGTGGG + Intergenic
1004769903 6:18770015-18770037 GGGGAATATTTTAAGGGGGATGG + Intergenic
1007080213 6:39095465-39095487 GGGTGCTATTTTAGGCTGGATGG + Intergenic
1007869723 6:45020438-45020460 AGTTATTATTTTAATTTGAAAGG + Intronic
1008090970 6:47293461-47293483 GGATAATATTTTAAGTTTGCAGG - Intronic
1008355944 6:50553272-50553294 GGTTATTATTTTAATTAGGGGGG - Intergenic
1008657027 6:53625942-53625964 GAATAGTATATTAAGTTGGAGGG + Intergenic
1009303579 6:62059490-62059512 ATTTATTATATTAAGTTGGAGGG + Intronic
1012065302 6:94542633-94542655 GGGTCCTATTTAAAGGTGGAGGG + Intergenic
1012216421 6:96591474-96591496 TGGTATTATTTTAACGTGGGTGG + Intronic
1012351664 6:98259235-98259257 GGGTGTTCTTCTAAGGTGGAAGG - Intergenic
1014627329 6:123743530-123743552 TGATATTATTTTTATTTGGAAGG - Intergenic
1015468126 6:133570999-133571021 CGGTATTATTTTAAATTGAAAGG + Intergenic
1017721585 6:157246684-157246706 GGTGATTATTTTTAATTGGATGG - Intergenic
1018635637 6:165856934-165856956 GAGTGTGATTTTTAGTTGGAAGG - Intronic
1021863115 7:24926950-24926972 TGGCATTATTTTGAGTTGAATGG + Intronic
1022996681 7:35763089-35763111 GGGGACTATTTTAAATAGGATGG + Intergenic
1024658940 7:51475142-51475164 GGGTATTTCTTTTAGGTGGAAGG + Intergenic
1024781771 7:52859074-52859096 GGGTATTAATTAAATATGGATGG + Intergenic
1027992360 7:85378918-85378940 GAGTATTATTTTAAGAAGGGAGG + Intergenic
1029797714 7:102912539-102912561 GGAAAATATTTTAAGTTTGAGGG - Intronic
1031021767 7:116636237-116636259 GGGTAGGTGTTTAAGTTGGAGGG - Intergenic
1032812728 7:135438012-135438034 GTGTATTATTTTAAGATATAAGG - Intronic
1033526814 7:142224179-142224201 GAGTTTTGTTTTGAGTTGGAAGG - Intergenic
1033827616 7:145210764-145210786 GGGTACTATTTTAAGAAAGAGGG + Intergenic
1033925045 7:146448329-146448351 GGGAAATATTTTGAGCTGGAAGG - Intronic
1034953990 7:155321994-155322016 GGCTGTGATTTTAAGTAGGATGG + Intergenic
1036060612 8:5314962-5314984 GTGAAGTATTTTCAGTTGGAAGG + Intergenic
1037037425 8:14184842-14184864 TGGTATAGTTTTAAGTTAGAGGG - Intronic
1039265810 8:35822770-35822792 GGGTATTATTTGAGGGTGGAGGG + Intergenic
1039362995 8:36900364-36900386 GCGTTTTATTTTACCTTGGAGGG - Intronic
1039976131 8:42366534-42366556 CGGTATTTTTTTAAGTTCCAGGG - Intronic
1040825000 8:51611362-51611384 GGTTAGTTTTTTAAGTGGGATGG + Intronic
1041033482 8:53762384-53762406 TGATATTATTTTAATTTGGAAGG - Intronic
1042236889 8:66622240-66622262 GGGTGCTATTTTAAATTTGATGG - Intergenic
1044357559 8:91241761-91241783 GGGGATTATTCTAAGATGGAGGG - Intronic
1044503092 8:92984746-92984768 GGTTATTATTTTAGGTAGGCTGG + Intronic
1044719230 8:95129742-95129764 TAGCATCATTTTAAGTTGGAGGG + Intergenic
1044960016 8:97521453-97521475 ATCTTTTATTTTAAGTTGGAGGG - Intergenic
1048107218 8:131424643-131424665 GGGTATTATTTTAAATAGGTTGG + Intergenic
1048452274 8:134543867-134543889 GGGCATTGTTTTAAGTGGGGAGG - Intronic
1050077534 9:1880679-1880701 GGGCATTATTCTAAGTATGAGGG + Intergenic
1050383648 9:5060211-5060233 GGGTATTATTTTGATGTTGATGG + Intronic
1051416383 9:16845269-16845291 GGGCATTTTTTTAAAATGGAGGG + Intronic
1055907807 9:81314353-81314375 GGATATTATAAAAAGTTGGAGGG - Intergenic
1058248321 9:102659104-102659126 GAGTATTATTCTAAGTAGTAGGG - Intergenic
1059543267 9:115151671-115151693 AGGTATATTTTAAAGTTGGAAGG + Intronic
1059847004 9:118291144-118291166 GGGCATTTTTTTAATTTGGGGGG + Intergenic
1059932964 9:119279505-119279527 GGGTATTATTTTAAGTGCTGAGG - Intronic
1060013574 9:120066319-120066341 GGGAAATGTTTTAGGTTGGAGGG - Intergenic
1060380851 9:123170215-123170237 GGGTTTTCTTGTAAGTTGGGAGG - Intronic
1061279731 9:129590650-129590672 GGGTTTTATTCTGAGTTGGTGGG + Intergenic
1202630663 M:13859-13881 GGATTTTATTTTAAGTTTGTTGG - Intergenic
1185809431 X:3092496-3092518 GGGTATGACTTTAATTTCGATGG + Intronic
1187131741 X:16509563-16509585 ATCTATTATTTTAACTTGGAAGG - Intergenic
1188783075 X:34309111-34309133 ATGTATTATTTTGAATTGGATGG - Intergenic
1188796700 X:34475720-34475742 GGGGACTACTTGAAGTTGGAGGG - Intergenic
1193575449 X:83190055-83190077 GGGTATCATTGCAAGGTGGATGG + Intergenic
1194879444 X:99233209-99233231 AGGTATTATTTTTATTTAGATGG - Intergenic
1199611517 X:149620275-149620297 GAGTATCATTTTTATTTGGAAGG - Intronic
1201926389 Y:19292605-19292627 GGATATTGTTTAAAGTTGGTAGG + Intergenic
1202085298 Y:21130141-21130163 GAATTTTATTTTAAGATGGAGGG - Intergenic