ID: 982148713

View in Genome Browser
Species Human (GRCh38)
Location 4:152427926-152427948
Sequence CTGGTTGCTGAACCTTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982148713_982148716 1 Left 982148713 4:152427926-152427948 CCTGCAAAAGGTTCAGCAACCAG 0: 1
1: 0
2: 0
3: 9
4: 127
Right 982148716 4:152427950-152427972 GGTCCCCAGACCAAATTTTAAGG 0: 1
1: 0
2: 4
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982148713 Original CRISPR CTGGTTGCTGAACCTTTTGC AGG (reversed) Intronic
905022747 1:34828924-34828946 CTGGTTACTTAACCTTTTTAAGG + Intronic
905086024 1:35377786-35377808 ATGGTTGCTGAAGGTTTTGGTGG + Intronic
906462087 1:46042403-46042425 GTGGTTTCTGAAGCTTTTGCAGG - Exonic
907747861 1:57232920-57232942 CTGCCTGCTGAACATTTTACTGG - Intronic
909760986 1:79286811-79286833 CAGGTTGCTGAATTTTATGCTGG + Intergenic
909929555 1:81480110-81480132 CTGGTTGAAGAATCTTTAGCTGG - Intronic
910863990 1:91770882-91770904 CTGCTTTCTGAATCTTTTGTGGG + Intronic
910958954 1:92740239-92740261 CTGGTTCCTGTACTTTTTGAAGG - Intronic
917580053 1:176367632-176367654 CTGGTTGTTAAACATTTTTCAGG + Intergenic
919370333 1:196716529-196716551 CTGGATGCTGTACTTTTTGTAGG + Intronic
919429731 1:197477720-197477742 CTTGTTACTGATCCTCTTGCTGG + Exonic
920244278 1:204576236-204576258 CTTGCTGCTGGAACTTTTGCTGG - Intergenic
920519788 1:206614719-206614741 CTGCTGGCTGACCCTATTGCAGG + Intergenic
921512255 1:216046569-216046591 CTGGTGGCTGAACCTCTTGTGGG + Exonic
1062895524 10:1100431-1100453 TTGTTTTCTGAAGCTTTTGCCGG + Intronic
1065757038 10:28940127-28940149 CTGTTTGCTGAACCCTTGGCGGG + Intergenic
1066100524 10:32114136-32114158 CTGTTTCCTGAACCTTTTTTAGG + Intergenic
1066443598 10:35461577-35461599 CGGGTTTCTGAACCTTCTCCTGG - Intronic
1070321496 10:75358141-75358163 CTGGTTCCCTAAGCTTTTGCTGG + Intergenic
1070381160 10:75881717-75881739 CTGGTTACAGAATCTTTTGGGGG - Intronic
1072288558 10:93940824-93940846 CTGGTTGCTGAATCCTCCGCAGG - Intronic
1072945973 10:99810454-99810476 CTGCTTTCTGGATCTTTTGCAGG - Intronic
1075225271 10:120623445-120623467 CTGGTTGCTGAAGGTTTGGGTGG - Intergenic
1075728227 10:124621433-124621455 CTGGTTGCTGTAGCTCCTGCCGG - Exonic
1076104068 10:127806243-127806265 TTGGTTGCTGACACTTCTGCTGG + Intergenic
1079332867 11:19547988-19548010 CTGGTTATTTAACCTCTTGCAGG - Intronic
1080355686 11:31442518-31442540 CTGGTTTTTGAAACTTTTGAAGG - Intronic
1082221150 11:49638770-49638792 GTGGTTTCTGAACATTTAGCAGG - Intergenic
1084359738 11:68661609-68661631 GTGGTGGCTGCAGCTTTTGCTGG + Intergenic
1087072048 11:94090788-94090810 CTGGTTTTTGAACCATTTGTGGG + Intronic
1087219314 11:95528887-95528909 CTGCTTACTGTTCCTTTTGCTGG + Intergenic
1088861217 11:113801388-113801410 CTGGTTGCCAAACCTTTTTAAGG - Intronic
1090338264 11:125990165-125990187 CTGGGTAGTGTACCTTTTGCTGG - Intronic
1096922632 12:55103983-55104005 CTGGCTTCTGCACCTGTTGCTGG + Intergenic
1103621304 12:122189044-122189066 CTGGGAGCTGAACCATCTGCAGG - Intronic
1109258304 13:60111235-60111257 CTGGATGCCTAACCTTTTTCTGG - Intronic
1115304858 14:31923492-31923514 CTGGATGCTCAACATTTTGAAGG - Intergenic
1117761136 14:59029961-59029983 CAAGTTGCTTAACCTTTTGGAGG - Intergenic
1120249501 14:82045517-82045539 CTGTTAGCTGAACATTTTCCTGG - Intergenic
1123820349 15:24023439-24023461 CTGGTTGCTGAACTATTTATAGG + Intergenic
1130283864 15:82539989-82540011 CTTGTTGCGGAGCTTTTTGCTGG + Exonic
1130576782 15:85100104-85100126 CTGATTGCTGAAAATCTTGCTGG - Intronic
1133490275 16:6261516-6261538 CAGGCTGCTGAGCCATTTGCTGG + Intronic
1137815896 16:51397261-51397283 CTGGTTGCTGCACCCTTTGGAGG + Intergenic
1140457522 16:75113821-75113843 CAGCTTGCTGTACCTGTTGCAGG + Exonic
1141169085 16:81680047-81680069 GTGGTTGCTGGACCTTTCGGAGG + Intronic
1143655408 17:8290863-8290885 CTGGTTGTAGAGCCTTGTGCAGG + Exonic
1143873339 17:9973693-9973715 CTGGGTGCAGTGCCTTTTGCGGG - Intronic
1146140858 17:30366852-30366874 CTGGTAACTGAACATTTTTCTGG + Intergenic
1148321565 17:46758719-46758741 CTTGTTGCTGAAACTTTTAAAGG - Intergenic
1148643812 17:49207444-49207466 CTGGCTGCTGAATCCTTTCCAGG - Exonic
1149200286 17:54177739-54177761 CTGGTTGCTGAAGATGTTGTGGG - Intergenic
1150917543 17:69451831-69451853 CTAGTTGCTGAGCCTTCTCCAGG - Intronic
1151315589 17:73320113-73320135 CTGGTATCTGTACCTTTTGTTGG + Intergenic
1153294675 18:3534269-3534291 CTGGTTCCTGAAGCTTCTCCAGG - Exonic
1155261644 18:24049517-24049539 CTGGGTGCTGAACCCTGTGCTGG + Intronic
1155386912 18:25288040-25288062 CTTGTTGCTGAAACTATTGGGGG - Intronic
1161057147 19:2196282-2196304 CTGGCAGATGAACCTTTTGGAGG + Intronic
925028135 2:625525-625547 GTGGTTACTGAACCTGTTGGAGG - Intergenic
925450836 2:3968200-3968222 CTGGTGGCTGAACCCTGAGCTGG - Intergenic
927058764 2:19392979-19393001 CTAAAAGCTGAACCTTTTGCTGG + Intergenic
929994723 2:46818106-46818128 CGGGTTGCTGCACCTGTTTCTGG - Intronic
934790629 2:97056831-97056853 CTGGCTGCTGAAACTGATGCTGG + Intergenic
934815831 2:97325698-97325720 CTGGCTGCTGAAACTGATGCTGG - Intergenic
934821864 2:97382785-97382807 CTGGCTGCTGAAACTGATGCTGG + Intergenic
935376959 2:102409479-102409501 CTGGTTGCTGACCATTTGCCTGG - Intergenic
943011191 2:182451693-182451715 CTAGTTGCTTAAACTTTTGATGG + Intronic
946013365 2:216584381-216584403 CTGGTTGCTGAACCTTCTCTAGG + Intergenic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1169420421 20:5454535-5454557 CTGGATCCTGAACTTTTTCCTGG - Intergenic
1170283461 20:14678128-14678150 CTGGTTGCTGCACCATCTCCTGG + Intronic
1172128415 20:32639187-32639209 CTGTGTGCTGAGCCCTTTGCTGG - Intergenic
1174862746 20:54107038-54107060 CTAGTTGCTGAACCTTCAGTTGG - Intergenic
1181313743 22:21959275-21959297 CGTGTTGCGGAGCCTTTTGCTGG - Intronic
1181940075 22:26468894-26468916 CTTGTTGATGAACATTTTGGTGG - Intronic
1185246583 22:49776221-49776243 CCTGTTGCTGCACCTTTTGTGGG - Intronic
949118390 3:356573-356595 CTGGGTCCTGAACCTCTTTCAGG - Intronic
950657313 3:14444716-14444738 CTGGTTTCTTAACCTTTTGTAGG + Intronic
950965256 3:17141509-17141531 GTGGTTGCTGAGCCTTGGGCTGG - Intergenic
952184805 3:30957088-30957110 CTGGTTTATGAACATTGTGCCGG + Intergenic
954151844 3:48661847-48661869 CGGGGTGCTGAACCTGATGCAGG + Exonic
954676410 3:52318010-52318032 CTGGTTGCTGAGCCTTGGCCAGG + Intronic
957476821 3:80736351-80736373 GTGGTTGCTGAACGTTTGGGTGG - Intergenic
957783048 3:84844602-84844624 CTGGTTGCTGAAGATTTGGGTGG - Intergenic
957798225 3:85039884-85039906 TTGGCTGCTGAAACTATTGCTGG - Intronic
962649569 3:137475088-137475110 CTGGTTGCTGTATCTTTTACAGG - Intergenic
965132382 3:164717628-164717650 CTGCTTTCTGAAGCTTTTGACGG - Intergenic
968127450 3:196170186-196170208 CTGGCCTCTGAACCTTCTGCTGG - Intergenic
972690361 4:41391294-41391316 CTGGTTGCTGATCCAATTGTTGG + Intronic
975374023 4:73621431-73621453 CTGCCTGCTGAACTTTTTGCAGG - Intergenic
976203403 4:82601429-82601451 ATGTGTGCTGAACCCTTTGCAGG - Intergenic
977639376 4:99339248-99339270 CTGGTTGCTTAAACTTTTTTTGG + Intronic
978906615 4:114012908-114012930 CTGGGTGCTGAACCCACTGCGGG - Intergenic
982077401 4:151751239-151751261 CTGGTTTCTCAGCCTTCTGCTGG - Intronic
982148713 4:152427926-152427948 CTGGTTGCTGAACCTTTTGCAGG - Intronic
984224017 4:177013590-177013612 ATGGTTGATGAACCTATTACCGG + Intergenic
985669638 5:1200818-1200840 CTGGGTCCTGAACCTATGGCCGG + Intergenic
987022469 5:13888892-13888914 CTTATTGCTGAACCTTTAGATGG - Intronic
988484379 5:31656371-31656393 TTTGTTGGTGAACCTTTTGATGG + Intronic
989003932 5:36788933-36788955 CTGTTTCCTGATCATTTTGCAGG + Intergenic
989272518 5:39549768-39549790 CTGGTTTTTGAAACTTCTGCTGG - Intergenic
990281347 5:54253910-54253932 CTGGTTTCTTAACCTTATGTAGG - Intronic
990766710 5:59192003-59192025 TTGTTTGCTGAAGGTTTTGCTGG - Intronic
993021899 5:82602082-82602104 CTTGTTGCTGCATCCTTTGCAGG + Intergenic
993737707 5:91497751-91497773 CTTGTTACTTAACCTCTTGCTGG + Intergenic
998657463 5:144197742-144197764 CTGGTTACTTAACCTCTTGGAGG + Intronic
1001190603 5:169627275-169627297 CTGGATGCTGAACCACTTACTGG + Intergenic
1001388257 5:171357746-171357768 CTGGTTTCTGAACCTTTGCAGGG - Intergenic
1001897935 5:175397367-175397389 CTGGTTGTTTAACTTTTTGACGG - Intergenic
1011191764 6:84737177-84737199 CTGGTTGGTGAGCCTGTTGTAGG + Exonic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1013858646 6:114606330-114606352 CTGGTTTCTTAACATTTTGAGGG + Intergenic
1015094896 6:129403561-129403583 CTGGTTGCAGAGACTTTTGGAGG + Intronic
1016781955 6:147968635-147968657 CTGGTTGGTGAACTTTTTTTTGG + Intergenic
1022836839 7:34125968-34125990 CTGGATGCTGAAGATTTGGCAGG + Intronic
1026032905 7:66810237-66810259 ATGTTTTCTGAACCTTTTTCAGG + Exonic
1028819411 7:95189270-95189292 CTGGGTGATGATCTTTTTGCTGG + Intronic
1034759653 7:153659341-153659363 CTGTCTTCTGAACCTTTAGCTGG - Intergenic
1035866855 8:3093335-3093357 CTGGATGCTGAACCTTTAAGCGG - Intronic
1039422132 8:37452026-37452048 TTGGTGGCTGAAGGTTTTGCGGG + Intergenic
1043613883 8:82101491-82101513 GTGGTTGCTGAACCTGATGTTGG + Intergenic
1044945660 8:97386571-97386593 CAGGTTACTTAACCTTTTTCTGG - Intergenic
1045167709 8:99625441-99625463 TTGGTTGCTGATCTTTTTGAAGG - Intronic
1045759315 8:105585334-105585356 CTGGGTGCTGATACTTTTGGAGG - Intronic
1047934637 8:129764834-129764856 CCGATTCCTGAACCTTTTGGGGG + Intronic
1049631078 8:143657970-143657992 CTGGTGCCTGAAGCTTTTCCAGG + Intergenic
1058969456 9:110066858-110066880 CTGTTTGCTGCAGTTTTTGCAGG + Intronic
1060527709 9:124329786-124329808 CTGTTTGCAGAACCTCTTGGTGG - Intronic
1060756084 9:126214979-126215001 CTGCTCCCTGAACCCTTTGCTGG + Intergenic
1186391909 X:9169349-9169371 CTTGTTGCTGTACCCTTTGGAGG + Intergenic
1190754143 X:53386557-53386579 GTTTTTGCTGAACCTTTTGAAGG - Intronic
1192875520 X:75225420-75225442 CTGGTTGCTGAGGCTGTTCCAGG - Intergenic
1193548160 X:82854683-82854705 CTTGTTGCTGTACATTCTGCAGG + Intergenic
1195432161 X:104801165-104801187 CTGTTTGCTGATCATTTTGAAGG - Intronic
1198999167 X:142612656-142612678 CTGTTTCCTGAAAATTTTGCAGG + Intergenic
1200404557 Y:2796734-2796756 ATGGTTGATGAACTTTTTTCTGG + Intergenic
1201964588 Y:19717774-19717796 CTGATTGGTGAAACTTTTTCGGG - Intronic