ID: 982149272

View in Genome Browser
Species Human (GRCh38)
Location 4:152434653-152434675
Sequence AAGGATATACAGAAGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 658
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 613}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982149264_982149272 9 Left 982149264 4:152434621-152434643 CCTATGCCATTCAATTTCCATAG 0: 1
1: 0
2: 2
3: 13
4: 177
Right 982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 613
982149267_982149272 -8 Left 982149267 4:152434638-152434660 CCATAGTTCCTTGACAAGGATAT 0: 1
1: 0
2: 1
3: 11
4: 109
Right 982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 613
982149265_982149272 3 Left 982149265 4:152434627-152434649 CCATTCAATTTCCATAGTTCCTT 0: 1
1: 0
2: 1
3: 32
4: 400
Right 982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982149272 Original CRISPR AAGGATATACAGAAGGGAGA GGG Intronic
900235992 1:1590938-1590960 AAGCAAAGACAGAAAGGAGATGG + Intergenic
902878346 1:19354428-19354450 AAGTAACTACAGAAGGGGGAGGG - Intronic
903229681 1:21914235-21914257 AAGGAAATACAGCAGGGTGAGGG + Intronic
903405850 1:23095165-23095187 AAGGAAATAGAGAAAGGGGAAGG + Intronic
903572217 1:24314383-24314405 AGGGATAGATAGAAGGGAGATGG - Intergenic
904092526 1:27955438-27955460 GAGGATTTACAGAAGTGAAAAGG + Intronic
904334737 1:29789615-29789637 AAGGACAAGGAGAAGGGAGAGGG + Intergenic
904820486 1:33239969-33239991 AAGGAAATAAAGTAGGGAGAAGG + Intergenic
904935305 1:34125959-34125981 AGTGATATTCAGAAGGGAGAGGG + Intronic
905649782 1:39648433-39648455 AAGGAGAGTGAGAAGGGAGATGG + Intergenic
905828309 1:41044198-41044220 AAGGATATAGGAAAGGGGGAGGG + Intronic
906398684 1:45489209-45489231 AAGGATTTCAAGAAGGGAGTGGG - Intronic
907588178 1:55640241-55640263 AAGGATGTGCAGGAGTGAGATGG - Intergenic
907664081 1:56418726-56418748 GATGGTATACAGAAGAGAGATGG - Intergenic
907709267 1:56863605-56863627 AAGGAGAGACAGAAGGTATAGGG - Intronic
907983723 1:59509624-59509646 AAGGACAGAAAAAAGGGAGAAGG - Intronic
908026464 1:59957245-59957267 TAGGATCTGCAGAAGGGAAATGG + Intergenic
909251630 1:73364353-73364375 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
910663261 1:89696453-89696475 AAGAACAGACAGAGGGGAGAGGG + Intronic
911360177 1:96866063-96866085 AAACATATACAGAAGGAAGATGG - Intergenic
911484464 1:98488250-98488272 AAGTATATACAGTAGGTAAAAGG + Intergenic
911708650 1:101043482-101043504 AAGCATATACAGTGGGGAAAGGG - Intergenic
911784328 1:101926000-101926022 AAGGATGCAGAGAAGTGAGATGG + Intronic
911930253 1:103893863-103893885 AAGAATATATAGAAGAGAGGAGG - Intergenic
912159550 1:106965108-106965130 AAAAATATTCAGAAGGTAGAAGG - Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912642491 1:111360774-111360796 AATCATATGCAGAGGGGAGATGG - Intergenic
913703984 1:121399713-121399735 AGGGATCTTCAGGAGGGAGATGG - Intergenic
913942632 1:125122209-125122231 AGGGATCTTCAGGAGGGAGATGG - Intergenic
913980332 1:143501421-143501443 AGGGATCTTCAGGAGGGAGATGG - Intergenic
914074680 1:144326909-144326931 AGGGATCTTCAGGAGGGAGATGG - Intergenic
914104496 1:144639537-144639559 AGGGATCTTCAGGAGGGAGATGG + Intergenic
914991557 1:152503324-152503346 AAGGATAGATGGAAGGGAAAAGG - Intergenic
914998829 1:152568621-152568643 AACAGTATACAGAAGGGGGAGGG - Intronic
916422603 1:164650876-164650898 AAGGAGGAAAAGAAGGGAGAAGG - Intronic
916559176 1:165918151-165918173 GAGGATATACTGATGGGAGATGG + Intergenic
916560210 1:165928601-165928623 AAAGATATCCAGGAGGGAGAGGG - Intergenic
916737302 1:167619356-167619378 AAGAATATAAAGAAAGTAGATGG + Intergenic
917260807 1:173166039-173166061 AAGGATGTGAAGAAAGGAGATGG - Intergenic
918691156 1:187480878-187480900 CAGGAACTACAGAAGGCAGAAGG - Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919424915 1:197417837-197417859 AAGGATAGAAAGAGGGAAGAAGG + Intronic
919435934 1:197561042-197561064 AACTATATTCAGAAGAGAGAAGG - Intronic
920081178 1:203373842-203373864 GAGGAAATACAGAAGGGAAAAGG - Intergenic
920232099 1:204477556-204477578 AAGGATGGAAAGAAAGGAGAGGG + Intronic
920403337 1:205691108-205691130 AAGGATATACAAATGGGAAGAGG - Intergenic
920897779 1:210075054-210075076 TGGGATAGCCAGAAGGGAGATGG + Intronic
921026379 1:211286913-211286935 AAGGATATACTGCAGGAAAAAGG - Intronic
921114935 1:212081144-212081166 AAGGAAATAGGAAAGGGAGAAGG + Intronic
921164145 1:212494056-212494078 TAGGCTAAACAGAAGGGAGTGGG - Intergenic
921877682 1:220217421-220217443 ATGGAAAAACAGAAAGGAGAGGG - Intronic
922085880 1:222346461-222346483 AATGAAAGAGAGAAGGGAGATGG + Intergenic
922350116 1:224728365-224728387 AAGGAGATACAATAGGGACATGG + Intronic
922575711 1:226659513-226659535 GTGGATACACAGAAGGGAGGAGG - Intronic
923027138 1:230214019-230214041 AATGAAATACAGAAGGAATATGG - Intronic
923412331 1:233722805-233722827 AAGGAAAGAAAGAAGGGAGGAGG - Intergenic
924501014 1:244638057-244638079 TTGAATATACAGAAGAGAGAAGG - Intronic
1063045704 10:2390407-2390429 AAGGGTATGAAGAAGTGAGAAGG - Intergenic
1063763288 10:9106818-9106840 AGGGATGTAGGGAAGGGAGAAGG + Intergenic
1064183714 10:13141847-13141869 CAGCATTTACAAAAGGGAGATGG - Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1066014392 10:31224914-31224936 AAGGAAATATTGGAGGGAGAGGG - Intergenic
1066252601 10:33649068-33649090 GTGGATATACAGCAGGGGGATGG + Intergenic
1066413163 10:35193345-35193367 AAGGAAAGAAAGAAGGGAAATGG - Intronic
1066781097 10:38945220-38945242 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1066953789 10:42146906-42146928 AGGGATCTTCAGGAGGGAGATGG + Intergenic
1067690294 10:48497463-48497485 AAGGAGATGCAGAAGGCAGAGGG + Intronic
1068118285 10:52758664-52758686 AAGGATAGAAAGATAGGAGAGGG - Intergenic
1068594080 10:58883608-58883630 AAGAAGAAAGAGAAGGGAGAAGG + Intergenic
1069277893 10:66615460-66615482 AAGGAGACACAGGAAGGAGAAGG + Intronic
1070036555 10:72730736-72730758 AATGATATACACATGGGAAAAGG - Intronic
1070236454 10:74632580-74632602 AAAGATATACACAGGGAAGAAGG - Intronic
1070513032 10:77178371-77178393 TAGGATTTAAAGAAGGGAGTAGG - Intronic
1070896209 10:79984436-79984458 CAGGATTTGAAGAAGGGAGAAGG + Intergenic
1070942826 10:80361636-80361658 AAGTAGATTAAGAAGGGAGAAGG - Intronic
1071223017 10:83491985-83492007 AGAGATACACAGAAGGAAGATGG + Intergenic
1071577604 10:86740871-86740893 AAGTAGATACAGATTGGAGAAGG + Intergenic
1071729346 10:88232431-88232453 AAAGATGTAGAAAAGGGAGAAGG - Intergenic
1072673026 10:97445692-97445714 AGGGAAAAACAGAGGGGAGATGG + Intronic
1072880988 10:99229372-99229394 AAGCTTTTACAGAAGGCAGAAGG - Intronic
1073009216 10:100346939-100346961 AAGGAGAAACAGAGGGGAGGGGG + Intergenic
1073032342 10:100536630-100536652 CAGGATATACAGCAGCGAGGAGG + Exonic
1073121758 10:101126144-101126166 ATGGATATATAGTAGGGAAAGGG - Intronic
1073920242 10:108450161-108450183 AAGGAAAGACAGGAGGGAGCAGG - Intergenic
1074429675 10:113383383-113383405 AAGGAAGGAAAGAAGGGAGATGG + Intergenic
1074694585 10:116037861-116037883 AGGGATATACTTAAGGAAGAAGG - Intergenic
1075173615 10:120139104-120139126 GAGTAGAAACAGAAGGGAGAGGG - Intergenic
1075652731 10:124139852-124139874 AGGGATATACAGTAGGGTCAGGG + Intergenic
1077527237 11:3074555-3074577 TGGGACACACAGAAGGGAGAAGG + Intergenic
1078114090 11:8427652-8427674 AACTTTATACAGAAGGGAGCAGG - Intronic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1078763401 11:14270668-14270690 AAGTATTCACAGAAGGGAAAAGG + Intergenic
1079363407 11:19788662-19788684 AAGGAGGTACAGGAGAGAGAGGG - Intronic
1079517656 11:21288063-21288085 AAGGAAATAAGGAAGGGAGAAGG + Intronic
1081095270 11:38924971-38924993 AGGGAGATAGAGAAGGAAGAAGG - Intergenic
1081215822 11:40396331-40396353 AATGATAAAAAGAATGGAGATGG - Intronic
1083541008 11:63511500-63511522 AAGGATGCAGTGAAGGGAGAAGG + Intronic
1083544328 11:63537784-63537806 AAGGAAATAGACAAGGAAGAGGG - Intronic
1084297564 11:68222734-68222756 AAGGAAACACAGGAGGCAGAAGG - Intergenic
1084548658 11:69827507-69827529 AAGGATACAAAGAGGTGAGAGGG + Intergenic
1084919589 11:72458299-72458321 AAGGAAGGAAAGAAGGGAGAGGG + Intergenic
1085372844 11:76026554-76026576 TAGGATACACAGAAGAGAGTTGG - Intronic
1085392288 11:76188681-76188703 AAACAGACACAGAAGGGAGAGGG + Intronic
1087248129 11:95864262-95864284 AAGAGTATACAGGAGGGAAAAGG + Intronic
1087407096 11:97744186-97744208 AAGGATATTTAGAAGGAAAAAGG + Intergenic
1087949636 11:104204871-104204893 AAGGAGGATCAGAAGGGAGAAGG - Intergenic
1088074939 11:105836481-105836503 AAGAATATACAGAGGGCAGATGG - Intronic
1088168842 11:106971566-106971588 AAGGATATAGACAAGCAAGAGGG + Intronic
1089185742 11:116613619-116613641 AACGATGGACAGACGGGAGAAGG + Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1092019468 12:5188831-5188853 ACAGATAGACAGAAGAGAGAGGG + Intergenic
1092460708 12:8683532-8683554 AAAGATATACAGATGGCAAATGG - Intronic
1092826132 12:12400717-12400739 AAGGATATAAAGGATGGGGAGGG - Intronic
1092913402 12:13167847-13167869 AGGGAGGTACAGAAGGGAAATGG - Intergenic
1093145987 12:15567464-15567486 AAGAATGGACATAAGGGAGAAGG - Intronic
1093495299 12:19749923-19749945 TAGGATGTACAGAAGGTACATGG + Intergenic
1094250529 12:28354985-28355007 AAGGAGAGGCAGGAGGGAGAAGG - Intronic
1094361734 12:29638400-29638422 ATGGGGATCCAGAAGGGAGATGG - Intronic
1095238752 12:39832015-39832037 AAGAGTTTACAGGAGGGAGAAGG - Intronic
1095487376 12:42699184-42699206 AATAATATAAGGAAGGGAGATGG - Intergenic
1095587804 12:43867426-43867448 AAGAGTATACAGATGGGACAAGG + Intronic
1097226211 12:57478033-57478055 AAGGGTCTACAGAAGGGAAGAGG + Intronic
1098855865 12:75652735-75652757 AAGAAAGAACAGAAGGGAGATGG + Intergenic
1099060068 12:77896951-77896973 AGGGAGGTACAGAAGGGTGAGGG - Intronic
1100665723 12:96750395-96750417 AGGGAGGAACAGAAGGGAGATGG - Intronic
1101557534 12:105824374-105824396 AAGTCTTTTCAGAAGGGAGAAGG + Intergenic
1101660397 12:106760024-106760046 AAGCCTAGACAGCAGGGAGAAGG - Intronic
1101728931 12:107410683-107410705 AAGGAGAAAGAGAAGGGACAAGG + Intronic
1101776825 12:107803079-107803101 ATGTATACCCAGAAGGGAGATGG - Intergenic
1102413195 12:112738134-112738156 AGAGATATACACAAGGAAGAAGG - Intronic
1102716032 12:114973677-114973699 AAGGAAAGAAAGAAGGGAGGAGG + Intergenic
1103358785 12:120341838-120341860 AGGGACACACAGAAGGGGGATGG + Exonic
1103862610 12:124026581-124026603 AAGGACCTTGAGAAGGGAGATGG - Intronic
1104133820 12:125918977-125918999 AAGAAGATAAAGAAGAGAGATGG + Intergenic
1104349845 12:128035697-128035719 AAGAAAATGCAGAAAGGAGATGG + Intergenic
1104508282 12:129353130-129353152 CAGGATAAAAAGAAGAGAGAAGG - Intronic
1104793206 12:131497176-131497198 AAGTATATTTAGAAGGGAAAAGG + Intergenic
1104947978 12:132425524-132425546 AGGGAGAGAGAGAAGGGAGATGG + Intergenic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106273414 13:28177488-28177510 AAGGATAAAAAGGAGGGTGAGGG - Intronic
1107315471 13:39126972-39126994 CAGGATATATAGAAGCCAGATGG + Intergenic
1108011932 13:46024315-46024337 AAGGATATACATCAGGAAGATGG - Intronic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1109230026 13:59745208-59745230 AAGGCAAAAGAGAAGGGAGATGG + Intronic
1109696880 13:65972326-65972348 AAAGAGATACAAAAGTGAGAGGG - Intergenic
1109917512 13:69010989-69011011 AAGGATAGAAAGAAGGCAGAGGG - Intergenic
1110074020 13:71215721-71215743 AAGATTATACAGAACAGAGATGG + Intergenic
1111146690 13:84191230-84191252 GAGGATGTACAGAAGTGACAAGG + Intergenic
1111559281 13:89923914-89923936 AAGTATACACTGAAGAGAGAAGG + Intergenic
1112164450 13:96903239-96903261 AAGGAAAGACAGAAAGCAGAGGG + Intergenic
1112676876 13:101711777-101711799 AAAAATGCACAGAAGGGAGATGG + Exonic
1113819450 13:113202722-113202744 AAGGAAATACAGGATGGAGAAGG + Intronic
1114161118 14:20168792-20168814 GAGGATAAAGAGGAGGGAGATGG + Intergenic
1115422487 14:33212598-33212620 AAGGATAGATACTAGGGAGATGG - Intronic
1115834162 14:37378708-37378730 AAGGAAAGGAAGAAGGGAGAGGG + Intronic
1116020987 14:39460707-39460729 AAGGATACAAAGAAGGTATATGG - Intergenic
1116392578 14:44411174-44411196 AAGGAAAGAAAGATGGGAGAAGG + Intergenic
1117664192 14:58039265-58039287 AAGGATAAAGAGAAGGGAATAGG - Intronic
1117787201 14:59298569-59298591 AAGGAAATAAAGAAAGGAAATGG - Intronic
1118845792 14:69547118-69547140 AAGGAATGACAAAAGGGAGATGG + Intergenic
1118893531 14:69927942-69927964 AAGAATAAACAGAGGGGTGAAGG + Intronic
1119972534 14:78987787-78987809 AGTTATACACAGAAGGGAGAGGG - Intronic
1119991271 14:79200381-79200403 AAGGAAACACTGAAGAGAGAAGG + Intronic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122315950 14:100826244-100826266 AAGGATGTGCAAAAGGAAGACGG + Intergenic
1202939493 14_KI270725v1_random:133959-133981 AGGGATCTTCAGGAGGGAGATGG + Intergenic
1123393647 15:19901956-19901978 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124855255 15:33381471-33381493 GAGGACAGACAGCAGGGAGATGG - Intronic
1125319393 15:38468038-38468060 AAGGATCTGCAAAAGGAAGAAGG + Intronic
1126107924 15:45159110-45159132 TAGGATATTCAGGAGGCAGAGGG + Intronic
1126196478 15:45937272-45937294 GGGGATATGCAGAAGGGTGATGG - Intergenic
1127238578 15:57084739-57084761 AAGAATATATAGAAGGCAAAGGG + Intronic
1127797708 15:62452792-62452814 AAGGACAGGCAGAAGGGAGCAGG - Intronic
1128538511 15:68508655-68508677 AGGGAAATTTAGAAGGGAGAAGG - Intergenic
1128585197 15:68843163-68843185 AAGGATAGAAAGAAGGGAGGGGG + Intronic
1128607148 15:69045500-69045522 AAAGAAAGAAAGAAGGGAGAGGG - Intronic
1128773637 15:70302259-70302281 AAGGATGGACAGAGGGTAGATGG + Intergenic
1129277856 15:74459165-74459187 AGGGGCATACAGAAGGGAGAGGG - Intronic
1129596736 15:76970634-76970656 AAGGAGGTACAGATGGAAGAAGG + Intergenic
1129849774 15:78786622-78786644 AAGGAAAGACTGAAAGGAGAAGG - Intronic
1130263367 15:82377064-82377086 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1130277936 15:82492602-82492624 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130301883 15:82686318-82686340 TAGGATTGAAAGAAGGGAGAAGG + Intronic
1130470266 15:84219787-84219809 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130477754 15:84334354-84334376 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130494011 15:84453776-84453798 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1130592555 15:85224415-85224437 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130704280 15:86217951-86217973 AAGGAGATACAGAGTGGATATGG + Intronic
1131476376 15:92743677-92743699 AAGGATGTAGAGAGGAGAGAAGG - Intronic
1131938385 15:97533436-97533458 ATGCATATGCAGGAGGGAGATGG + Intergenic
1131967477 15:97859520-97859542 AAGGATATCCAACAGGGAGGTGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132149893 15:99451903-99451925 AAGGATGGACAGAGGGGAGATGG - Intergenic
1132221601 15:100109326-100109348 AAGGATAGAGAGATGAGAGAAGG - Intronic
1132642865 16:985578-985600 AAAGAAAGATAGAAGGGAGAGGG - Exonic
1133207147 16:4240550-4240572 AAGGAAAGACAGCAGAGAGAAGG + Intronic
1133507476 16:6426296-6426318 AGGGAGAGAGAGAAGGGAGAAGG + Intronic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1134117560 16:11560685-11560707 AAGGTTATAGAGAAGGGGAAAGG + Intronic
1134126782 16:11621592-11621614 AAGGATAGACAGGAGTCAGAAGG + Intronic
1134143353 16:11741550-11741572 AAGCTTATACAAAAAGGAGAAGG - Intronic
1134308173 16:13052277-13052299 AAGCATATTCAGAAAGGAGGGGG - Intronic
1134777144 16:16863156-16863178 AAGGATAGAGAGGAGAGAGAGGG + Intergenic
1136695909 16:32081862-32081884 AGGGATCTTCAGGAGGGAGATGG + Intergenic
1136699652 16:32119325-32119347 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1136715946 16:32281502-32281524 AGGGATCTTCAGGAGGGAGACGG - Intergenic
1136751966 16:32648263-32648285 AGGGATCTTCAGGAGGGAGACGG + Intergenic
1136771263 16:32843575-32843597 AGGGATCTTCAGGAGGGAGATGG + Intergenic
1136796404 16:33025115-33025137 AGGGATCTTCAGGAGGGAGATGG + Intergenic
1136800144 16:33062501-33062523 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1136822622 16:33332203-33332225 AGGGATCTTCAGGAGGGAGACGG - Intergenic
1136829185 16:33388742-33388764 AGGGATCTTCAGGAGGGAGACGG - Intergenic
1136834251 16:33487524-33487546 AGGGATCTTCAGGAGGGAGACGG - Intergenic
1136868297 16:33773649-33773671 AGGGATCTTCAGAAGGGAGACGG - Intergenic
1136899312 16:34017878-34017900 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1136902545 16:34053765-34053787 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1136958042 16:34806512-34806534 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1137083868 16:36098745-36098767 AGGGATCTTCAGGAGGGAGATGG + Intergenic
1137243357 16:46679213-46679235 TAGGAAATACACAAAGGAGAAGG - Intronic
1137414786 16:48265475-48265497 AAGAATATACAATAGGGAAAGGG - Intronic
1137621819 16:49881287-49881309 AAGGAGCTCCAGGAGGGAGATGG - Intergenic
1137852895 16:51763912-51763934 AAGGAAAGAAGGAAGGGAGAAGG - Intergenic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1141113015 16:81285773-81285795 AAGGATGTTCAGCTGGGAGAGGG + Intronic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1203010665 16_KI270728v1_random:236996-237018 AGGGATCTTCAGGAGGGAGACGG + Intergenic
1203054108 16_KI270728v1_random:908249-908271 AGGGATCTTCAGGAGGGAGACGG + Intergenic
1203073686 16_KI270728v1_random:1105685-1105707 AGGGATCTTCAGGAGGGAGATGG + Intergenic
1142801604 17:2349745-2349767 AACCATATACAGAAGGAAAAGGG - Intronic
1144287829 17:13795642-13795664 AAGGTGATATAGGAGGGAGATGG - Intergenic
1144403450 17:14929295-14929317 AAGGAGACCCTGAAGGGAGAGGG + Intergenic
1144592872 17:16539604-16539626 GAGGAAAGAAAGAAGGGAGAAGG - Intergenic
1144801124 17:17928222-17928244 AAGGAAATAAATAAGGGGGAAGG + Intronic
1145690561 17:26734357-26734379 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1145710338 17:26965521-26965543 AAGGATCTTCAGGAGGGAGATGG - Intergenic
1145767072 17:27466028-27466050 AGGGATCTTCAGGAGGGAGATGG - Intronic
1146034299 17:29391575-29391597 ATGTATACACAGAAGGGAGGGGG + Intronic
1146157466 17:30535990-30536012 AAGCATATACAGTATTGAGATGG - Intergenic
1146809580 17:35892466-35892488 AAGGACAGCCAGAAGGGAGAAGG - Intergenic
1149150193 17:53552543-53552565 AAGGATATAGTGAAGGGAGGAGG + Intergenic
1149295898 17:55262700-55262722 AAGGATGGAGAGAAGTGAGAGGG + Intergenic
1149529972 17:57387326-57387348 AGGGATAAACAGAAGAGAAAAGG - Intronic
1149576739 17:57719076-57719098 GAGGACTTACAGAAGGGAAAGGG + Intergenic
1150596821 17:66613678-66613700 AAAGATACACAGAGAGGAGATGG - Intronic
1150809298 17:68344181-68344203 AAGGAAGAAGAGAAGGGAGATGG + Intronic
1150893059 17:69177011-69177033 GAGGATATGCAGAAGAGAGATGG - Intronic
1151121268 17:71796008-71796030 AAGGATATGAAGAACAGAGAAGG + Intergenic
1152022468 17:77787737-77787759 AAGGGCACACAGAAGAGAGAGGG + Intergenic
1152314299 17:79571389-79571411 AGGCATAGGCAGAAGGGAGAGGG - Intergenic
1153160641 18:2200956-2200978 GAGTTAATACAGAAGGGAGAAGG + Intergenic
1153179916 18:2421343-2421365 AAGGATGTGCAGTATGGAGATGG - Intergenic
1154517917 18:15195121-15195143 AGGGATCTTCAGGAGGGAGATGG + Intergenic
1155742698 18:29309870-29309892 AAGAATATATAGAAGAGAGTAGG - Intergenic
1155958746 18:31976214-31976236 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1155986590 18:32236770-32236792 AAGTATACACAGACAGGAGAAGG + Intronic
1156111416 18:33731824-33731846 AAGGAGACAGAGAAAGGAGAAGG - Intronic
1157410400 18:47458440-47458462 AAGGGGAGACAGAAGAGAGAGGG + Intergenic
1157491494 18:48126915-48126937 AAAGAAATAGAGATGGGAGAGGG + Intronic
1158187861 18:54791942-54791964 ATGGAGAGCCAGAAGGGAGATGG - Intronic
1158253542 18:55517880-55517902 AAGGTCAAACAGAAGAGAGATGG - Intronic
1158323452 18:56289054-56289076 AAGGATAAACAGATGGGTCAAGG + Intergenic
1158707734 18:59808558-59808580 AAGGAGCTACAGGAGAGAGAAGG + Intergenic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1159095378 18:63895707-63895729 AAGGATTTCCAGAGGAGAGAGGG + Intronic
1159544967 18:69828917-69828939 AAGGAGAGAGTGAAGGGAGAAGG + Intronic
1159571520 18:70119467-70119489 AAGGAGAAAGGGAAGGGAGAAGG + Intronic
1159964064 18:74579170-74579192 AAGGAAAGGGAGAAGGGAGAAGG - Intronic
1160357646 18:78241880-78241902 AAGGACACACAGATGGGAGTGGG + Intergenic
1161494170 19:4578696-4578718 AAGGTTATAGAGCAGGGGGAGGG - Intergenic
1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG + Intronic
1161933711 19:7357967-7357989 AAGCACATATAGAAGGAAGAGGG - Intronic
1162164954 19:8745997-8746019 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162166025 19:8753461-8753483 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162167091 19:8760917-8760939 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162169100 19:8774673-8774695 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162182212 19:8877908-8877930 AAGGATAGACAGATGTTAGAAGG - Intronic
1162788694 19:13052019-13052041 AAGGAAAGACAGAAGGGAAATGG - Intronic
1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG + Intergenic
1164794469 19:31014884-31014906 AAGGAGATATAGAAAAGAGAGGG + Intergenic
1164806086 19:31118180-31118202 AAAGAAATGCAGATGGGAGAAGG + Intergenic
1164836443 19:31357911-31357933 AGGGATATACATAAGGCATAAGG + Intergenic
1165993144 19:39827188-39827210 AGGGAAAGACACAAGGGAGAGGG + Intronic
1166294505 19:41882560-41882582 AGGAAGAGACAGAAGGGAGAAGG + Intergenic
1166432689 19:42740579-42740601 AAGGAAAAACAGGAGGGACAAGG - Intronic
1166435797 19:42765776-42765798 AAGGAAAAACAGGAGGGACAAGG - Intronic
1166445272 19:42853238-42853260 AAGCAGAAACAGAAGAGAGAAGG - Intronic
1166485095 19:43205731-43205753 AAGGAAAAACAGGAGGGACAAGG - Exonic
1166818310 19:45560498-45560520 CAGGAGAGAGAGAAGGGAGATGG - Intronic
1167810724 19:51827926-51827948 TAGGAGAGACAGAAGGGAAAAGG - Intergenic
1168278350 19:55289454-55289476 AAGGATATAGAGGGGGCAGAGGG - Intronic
1168556017 19:57340618-57340640 AACGATCTACAGAAGTGAGAGGG - Intergenic
1202670211 1_KI270709v1_random:43024-43046 AGGGATCTTCAGGAGGGAGATGG - Intergenic
926269844 2:11356956-11356978 AAGGAATCACAAAAGGGAGAAGG - Intergenic
926472836 2:13282562-13282584 AAGGTCCTTCAGAAGGGAGATGG + Intergenic
927211176 2:20640136-20640158 ACGGATGTAAAGAGGGGAGAAGG + Intronic
927725725 2:25421202-25421224 AAGGAATTACGAAAGGGAGAGGG + Intronic
927877330 2:26666998-26667020 AAGGAAAGAGAGAAGGAAGAAGG - Intergenic
927932845 2:27056573-27056595 AAGGAGAGACAGAAGGGACAAGG - Intronic
928921831 2:36534662-36534684 AAGGAAATACAGGAAGGAAAAGG + Intronic
928958663 2:36898877-36898899 AAGGAGAGAGAGAAGGGAGAAGG + Intronic
929042799 2:37761798-37761820 AAGGAGATAGAGACAGGAGATGG + Intergenic
929594668 2:43168706-43168728 AAGGATAAACAGAAGGGCTCTGG + Intergenic
930409057 2:51000261-51000283 AAGGACATAGAGAATGGATAAGG - Intronic
930702664 2:54474703-54474725 AAAAATATACAAAAGGGATAAGG + Intronic
931494323 2:62785597-62785619 AAAGATATCCAGAAGGCAGTTGG + Intronic
931892731 2:66692375-66692397 AAGGACATACAGAAGCGGGCAGG + Intergenic
932067567 2:68582517-68582539 AAGGGAATACAGAAAGTAGAGGG + Intronic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
933103991 2:78298566-78298588 AATGATATATTGAAGGGTGATGG - Intergenic
933148963 2:78891346-78891368 AAGGAGAGACAGAAGGAAGGAGG - Intergenic
933295284 2:80483228-80483250 AATGAAAGAAAGAAGGGAGAGGG - Intronic
933369302 2:81395062-81395084 AAGAAAATAAAGAAGGGGGAGGG + Intergenic
933374157 2:81457966-81457988 AAGGATATTCAAAAGTGAGAGGG + Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934251208 2:90357393-90357415 AGGGATCTTCAGGAGGGAGATGG + Intergenic
934258353 2:91446008-91446030 AGGGATCTTCAGGAGGGAGATGG - Intergenic
935403303 2:102682697-102682719 AAGGATAAAAAGAAGTGAGTGGG + Intronic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936432279 2:112474905-112474927 TAGGATACAAAGAAGAGAGATGG + Intergenic
937615835 2:123921358-123921380 AAGGAAAGAAAGAAGGAAGAAGG + Intergenic
937818214 2:126276433-126276455 AAGGAGAAAAGGAAGGGAGAAGG + Intergenic
937834850 2:126461613-126461635 AAGGAGAGACAGAAGGGATTAGG - Intergenic
939131245 2:138237980-138238002 AAGGAAATACAGTTGGAAGAAGG - Intergenic
939400144 2:141682150-141682172 AGGGATATAGAAAATGGAGATGG + Intronic
939428253 2:142069062-142069084 AAAAATACAGAGAAGGGAGAAGG - Intronic
939901075 2:147850193-147850215 AAGGAAGTACAGAAGGGTCAGGG - Intronic
939902841 2:147870820-147870842 AAGTATATAAAGAAGGAAGAGGG - Intronic
942032585 2:171977761-171977783 AAAGGAATACAGAAGGAAGAAGG - Intronic
942268324 2:174249021-174249043 AAAGTTATAGAAAAGGGAGATGG - Intergenic
942477711 2:176345564-176345586 AAGGATAGAGATAGGGGAGAAGG + Intergenic
942919104 2:181349477-181349499 ATGGATAGACAGAAGAGAGTGGG + Intergenic
943465394 2:188222901-188222923 AAAGACACACAGAAGGAAGATGG - Intergenic
944340564 2:198592319-198592341 AATGACATAAAGAAGTGAGATGG + Intergenic
944455230 2:199886725-199886747 AACAATATAGAGAAGAGAGAAGG + Intergenic
945216093 2:207435769-207435791 ATGTATATAGAGAAGGGATATGG - Intergenic
945323097 2:208449896-208449918 AAGGATATACAGAAACCATAAGG - Intronic
945949931 2:216029518-216029540 AATGATAAACACAAGGCAGAAGG + Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946513802 2:220389358-220389380 AAGGAAAGAAAGAAGGGAGAGGG - Intergenic
946564503 2:220948720-220948742 ACGGAAATAGAGAAGGGAGGTGG + Intergenic
946832114 2:223737525-223737547 AAGGAGAAAGAGAAAGGAGAGGG - Intergenic
947032135 2:225808327-225808349 AAGGATATAAACAATTGAGAGGG - Intergenic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
948091800 2:235301757-235301779 AAGGATAACGAGGAGGGAGAAGG - Intergenic
948558769 2:238836350-238836372 AAGCATAGAGAGAAAGGAGAGGG + Intergenic
1169461196 20:5797160-5797182 AAGGAAAAACAAAAGGGGGAAGG + Intronic
1170214975 20:13882243-13882265 GGGGAGATACATAAGGGAGAGGG - Intronic
1171109835 20:22470822-22470844 AAGGAAATAGAGCAGGGAGGAGG + Intergenic
1172163922 20:32887156-32887178 ATGGATAATCAGAAGGGATAGGG - Intronic
1172166612 20:32903407-32903429 GTGGACACACAGAAGGGAGATGG - Intronic
1172811258 20:37649945-37649967 AAGGAAAAGAAGAAGGGAGAAGG + Intergenic
1173000768 20:39103992-39104014 GAGGACATACACAAAGGAGAAGG - Intergenic
1173079387 20:39851220-39851242 AAGGAAAGACAGAAGCCAGAAGG - Intergenic
1173168417 20:40702480-40702502 ATGGAAATAGAGAAGGGAGTTGG + Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173714898 20:45194905-45194927 AAGGAAAGAGAGAATGGAGATGG + Intergenic
1173891085 20:46510898-46510920 AAGGATGTCCAGAAGGCACATGG - Intronic
1174214652 20:48906963-48906985 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
1175055426 20:56193326-56193348 AAGGCAATACAGGATGGAGATGG - Intergenic
1175199742 20:57268704-57268726 GAGGACATGCAGGAGGGAGAAGG + Intergenic
1175440117 20:58984470-58984492 TTGGATAGACAGATGGGAGATGG + Intronic
1175979952 20:62733634-62733656 AGGGAGATAGAGAAGAGAGAGGG + Intronic
1176525259 21:7861534-7861556 CAGGAAATACAGAGGAGAGAAGG - Intergenic
1176583699 21:8553130-8553152 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1177042297 21:16129168-16129190 AAGGATATTCAGATAGGAGGAGG - Intergenic
1177842661 21:26251981-26252003 AAGGAGATACTGAATTGAGAGGG - Intergenic
1178416519 21:32409778-32409800 AAGGATGTTTAGAAGGCAGATGG - Intergenic
1178659279 21:34491547-34491569 CAGGAAATACAGAGGAGAGAAGG - Intergenic
1179328027 21:40369182-40369204 AAAGATGTACAGAATGAAGATGG - Exonic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1180266509 22:10530063-10530085 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1181402987 22:22662636-22662658 CAGGATATACAGATTGGAGGTGG - Intergenic
1181829298 22:25546536-25546558 CAGGACATCTAGAAGGGAGAAGG - Intergenic
1182031561 22:27163166-27163188 AGGGAGATAAAGAAGGGAAAAGG + Intergenic
1182676545 22:32043588-32043610 AAGGATGAGCAGAAGTGAGAAGG + Intronic
1182747137 22:32614708-32614730 AATGATATACAAAAGGCCGAAGG + Intronic
1183153653 22:36057271-36057293 AAGTGTATACTGAAGGGAAAGGG + Intergenic
1183439648 22:37815979-37816001 AAGGAGACACAGAAGCTAGAGGG - Intronic
1183680998 22:39329133-39329155 AAGGATACACAGTAGTGACAGGG - Intergenic
1184021105 22:41822058-41822080 AAGGAGTTAGAGAAGGTAGAAGG + Intronic
1184912374 22:47544825-47544847 AAGGGTTGAGAGAAGGGAGATGG + Intergenic
1185001898 22:48251299-48251321 AAGGAAAGAAGGAAGGGAGAAGG - Intergenic
1203235897 22_KI270732v1_random:995-1017 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1203288858 22_KI270735v1_random:15085-15107 AGGGATCTTCAGGAGGGAGATGG + Intergenic
1203324640 22_KI270738v1_random:2278-2300 AGGGATCTTCAGGAGGGAGATGG + Intergenic
949237533 3:1828097-1828119 AAGAATAAACAGAAGAGATAGGG + Intergenic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950184300 3:10935590-10935612 CAGGAGATACAGCAGGTAGACGG - Intronic
950711729 3:14817993-14818015 AAGGATCTAGAGAAGGGGAACGG - Intergenic
951265527 3:20561338-20561360 AAAGATTAACAGAAGGGAAAAGG + Intergenic
951376054 3:21919134-21919156 AAGGATTTACAGAATGTTGAAGG + Intronic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952873802 3:37925102-37925124 AAGGATGGACAGAGGGGACAGGG - Intronic
952962100 3:38598769-38598791 AAGGCTACACAGAACAGAGAAGG + Intronic
953432262 3:42850029-42850051 AAGGATGTACAAAAGGGGGGAGG + Intronic
953667897 3:44939181-44939203 AAGGAGACACAAAAGGGACATGG + Intronic
954287781 3:49631012-49631034 AAGGACAGGAAGAAGGGAGAGGG - Intronic
954474027 3:50726358-50726380 AAGGAGATACAGGAGGTATAAGG + Intronic
955081622 3:55663119-55663141 ATGGATGAACGGAAGGGAGATGG + Intronic
955157412 3:56430243-56430265 AAAGAAATACAAAAGGGATAAGG - Intronic
956601039 3:71022808-71022830 AAGGATATGCAGATGGCATAGGG + Intronic
956633243 3:71336865-71336887 CAGGAGATAGAGAAGGCAGAGGG + Intronic
957638683 3:82820167-82820189 AAGGACTGACAGAACGGAGAAGG - Intergenic
958595899 3:96222334-96222356 TAGGATATACAGAATTAAGAGGG - Intergenic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
960139724 3:114140351-114140373 CAGGATATAAAGCAGGGACAAGG - Intronic
960356184 3:116656196-116656218 GAGGGAATAAAGAAGGGAGAGGG - Intronic
960851136 3:122055877-122055899 AATGAGATAGAGAAGGTAGAGGG + Intronic
962907256 3:139815424-139815446 AAGGAAAAATAGAGGGGAGAAGG - Intergenic
963124539 3:141802935-141802957 TAGAATATGCAGAAGGGAAAAGG - Intronic
963754895 3:149224558-149224580 AAAAATAAACAGGAGGGAGAAGG + Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
964218771 3:154320560-154320582 GAGGATTTGCAGGAGGGAGAGGG - Intronic
964734381 3:159901249-159901271 AAGGAGAAAGAGAATGGAGAGGG - Intergenic
964779299 3:160317688-160317710 AAGGAAACACAGAAGATAGAGGG + Intronic
964969814 3:162545708-162545730 AAGGGCTTACAGAAGAGAGAGGG - Intergenic
965117339 3:164507936-164507958 GAGCATATAAAGAAGGGAGATGG + Intergenic
965153349 3:165012038-165012060 AATGATAAACAGAAGGGAACAGG - Intronic
966181161 3:177189746-177189768 AAAAATTTACTGAAGGGAGATGG + Intronic
967558556 3:190890503-190890525 GAAGATATACAGAATGGAAATGG - Intronic
968358484 3:198128001-198128023 AAGGAGATTCAGCAGGAAGATGG - Intergenic
969171139 4:5364678-5364700 AATCATATTCAGTAGGGAGAGGG + Intronic
969172321 4:5374054-5374076 GAGGAAATGCAGAGGGGAGAAGG + Intronic
970022683 4:11586909-11586931 AAGGATACAGAGAAGGAAGCAGG + Intergenic
970971972 4:21995592-21995614 AAGGACATAAAGAAAAGAGAAGG + Intergenic
971216364 4:24665812-24665834 AAGGGCAGACAGAATGGAGAGGG + Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971474953 4:27064176-27064198 AAGGACAGACAGAAAGGAAAAGG + Intergenic
971642204 4:29148571-29148593 AAAGATGTACAGATTGGAGAAGG + Intergenic
972598553 4:40551597-40551619 AAGGAAGTACACAAGGAAGAGGG + Intronic
973284227 4:48397366-48397388 AAGGAAATACAGAAGGAAAGAGG + Intronic
973816053 4:54620080-54620102 AAGGAAAGACAGAAAGGAAAAGG - Intergenic
973956587 4:56069003-56069025 ACGGAGACATAGAAGGGAGAAGG + Intergenic
974636986 4:64577954-64577976 GAGGACATACAAATGGGAGAGGG + Intergenic
975058746 4:69970364-69970386 AATGATATATAGAATGGACAAGG - Intergenic
975788442 4:77920746-77920768 AAGGATGAATGGAAGGGAGAAGG - Intronic
975989260 4:80240185-80240207 AAGGATATACAATATGGATATGG - Intergenic
976626972 4:87195599-87195621 AAGGGTAGAGAGAAGGCAGAAGG + Exonic
976877240 4:89868276-89868298 AAAGATATAAAGAAGAGAAATGG + Intergenic
977048303 4:92094414-92094436 AAGGATAAAGAGAAGAGGGATGG - Intergenic
977368175 4:96100017-96100039 AAGGATATAGTGAAAGGAGCTGG + Intergenic
977609421 4:99016935-99016957 AAGAAAATACAGAAGGGAGATGG - Intronic
978048464 4:104164912-104164934 AAGGATGTAGAGAAAGAAGACGG + Intergenic
978619906 4:110627757-110627779 AAAGAAATAGAAAAGGGAGATGG - Intronic
979548685 4:121965522-121965544 GTGAATATAAAGAAGGGAGAGGG - Intergenic
980122730 4:128744354-128744376 AAAGATATACAGTAGGAATAGGG - Intergenic
980332338 4:131426066-131426088 AAGGATGGAGGGAAGGGAGAAGG + Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982049294 4:151484461-151484483 AAGGATACTAAGAAGGTAGAGGG + Intronic
982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG + Intronic
982374382 4:154673573-154673595 AAAGAAAGACAGCAGGGAGAAGG + Intronic
983311663 4:166071625-166071647 AAGGAAAGAGAAAAGGGAGAAGG - Intronic
983431019 4:167651590-167651612 AAGGATATACTGGTGGAAGAAGG + Intergenic
983583425 4:169331339-169331361 AAGGAAAAACAGAAGGGATAAGG - Intergenic
983890021 4:173021120-173021142 GAGGAAAGACAGAGGGGAGAGGG - Intronic
984081599 4:175254590-175254612 AAGGATTTCTAGGAGGGAGAAGG - Intergenic
984554723 4:181200026-181200048 AAGGATAGAGAGAAGGGAAGAGG - Intergenic
985440057 4:189976301-189976323 AAGGAGATTCAGCAGGAAGATGG + Intergenic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
987183221 5:15387654-15387676 AAGGATACACAAAAGAGGGAAGG + Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987630673 5:20467551-20467573 AAGGATAGAGAGAAGTGAGAAGG + Intronic
988707407 5:33739809-33739831 AAGGGTGTAAAGAAGGCAGAAGG + Intronic
988921538 5:35946883-35946905 AAGGATCCATAAAAGGGAGATGG - Intergenic
989136767 5:38163574-38163596 AAGAAAATACAGAAGGGAGAGGG - Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
990072268 5:51797825-51797847 ATGAATATTCAGAAGGGTGATGG - Intergenic
990740243 5:58905120-58905142 AATGGTACACAGGAGGGAGAAGG - Intergenic
991373919 5:65946013-65946035 AAGGGAATATAGGAGGGAGATGG - Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991605309 5:68395100-68395122 AAGGACATAGAGACAGGAGAGGG - Intergenic
991960434 5:72038945-72038967 AAGGATAGACTGCAGGGGGAAGG - Intergenic
992408527 5:76482521-76482543 TAGTACATACAGAAGGAAGAGGG + Intronic
993130168 5:83886838-83886860 AAGTACATAAAGAAGGGAGAAGG + Intergenic
993140547 5:84027702-84027724 CAGGATAGACAGCAGGGAGTGGG + Intronic
993326622 5:86546562-86546584 CAGGATTAAGAGAAGGGAGATGG + Intergenic
994253321 5:97563081-97563103 AGGGATATGGAGAAGGAAGAAGG + Intergenic
994285517 5:97960497-97960519 AAGGAAACAGAGAAGGGGGAAGG + Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
996906862 5:128610713-128610735 AAGGATAAAGGGAAGGGAGTTGG + Intronic
996949804 5:129111769-129111791 AAAGAGAGACAGAAAGGAGAAGG - Intronic
996998342 5:129726517-129726539 AAGGACTGAAAGAAGGGAGAAGG + Intronic
997742000 5:136263843-136263865 AAGGTTAGAGAGAAGGGAGGTGG + Intronic
997854199 5:137358497-137358519 AAGGAGAGACAGAAGGGAGGAGG + Intronic
998567834 5:143231814-143231836 AAGGAAAAACAGAACGGAAATGG - Intergenic
999463497 5:151777839-151777861 AAGGATTTCCTGCAGGGAGAAGG - Intronic
999913627 5:156233485-156233507 AAGGAAATACAAAGTGGAGAGGG + Intronic
1000590858 5:163155792-163155814 AATGATATGAAGAATGGAGAGGG + Intergenic
1000593750 5:163189970-163189992 AAGGATAAAGAGAAAGGAGAAGG + Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001461820 5:171922521-171922543 AAGGCAATTCAGAAGGAAGAAGG + Intronic
1001843153 5:174897738-174897760 CAGGTTATACAGCTGGGAGAGGG - Intergenic
1002472981 5:179448301-179448323 AAGGAAATAAAGCAGGGTGAGGG - Intergenic
1002481243 5:179502353-179502375 AAGGAAATAAAGCAGGGTGAGGG + Intergenic
1002844100 6:931088-931110 AGTGATATGCAGAAGAGAGAAGG + Intergenic
1002893266 6:1356279-1356301 AAGTATATACCCAAGGGAGTTGG + Intergenic
1003162232 6:3646135-3646157 AAGGAAACACCGAAAGGAGAAGG + Intergenic
1004378752 6:15114380-15114402 AAGGACACACAGATGGTAGATGG + Intergenic
1004536787 6:16510773-16510795 AAAGGTATACAGAAAGCAGAAGG + Intronic
1004617397 6:17303568-17303590 AAAGAGAAACAGAAGGGAAAAGG + Intergenic
1005719604 6:28588009-28588031 AAGGAAACAGAGAATGGAGAAGG - Intronic
1006697478 6:35943474-35943496 CAGAATACAGAGAAGGGAGAAGG + Intergenic
1007150970 6:39690565-39690587 AGGGACAGACAGGAGGGAGAAGG + Intronic
1007534691 6:42576022-42576044 AAGAAAAAACAGAAGGGAAAAGG - Intronic
1008077877 6:47164644-47164666 AAGGTTAAAGAGAATGGAGAAGG - Intergenic
1008464701 6:51817465-51817487 TATGATATACTGAGGGGAGAGGG + Intronic
1009044120 6:58216929-58216951 CAGGCTATACAGAAAGCAGATGG + Intergenic
1009219944 6:60971197-60971219 CAGGCTATACAGAAAGCAGATGG + Intergenic
1009367145 6:62864500-62864522 CATAATATACAGGAGGGAGAGGG - Intergenic
1009712131 6:67337499-67337521 AAGTACATACAGAAGGGTGATGG - Intergenic
1010355455 6:74927396-74927418 AAGGAAAGAAGGAAGGGAGAAGG + Intergenic
1011077850 6:83456859-83456881 TGGGATATACAGAAGAGAAAAGG - Intergenic
1011187007 6:84688757-84688779 AGGGATAAGCAGAACGGAGAAGG + Intronic
1011743337 6:90385374-90385396 AGTGATATACAGAAAAGAGAAGG - Intergenic
1012180059 6:96141584-96141606 AAGGCTGAACAGAAAGGAGAAGG + Intronic
1012333429 6:98023075-98023097 AAGGAGATGCAGAAGGAATATGG - Intergenic
1013547690 6:111175166-111175188 AAGGATTCAGAGAAGGGACATGG - Intronic
1013706219 6:112837677-112837699 ATGGATAGAGAGAAGAGAGAGGG - Intergenic
1014280581 6:119438705-119438727 AAGGATATACAAATGTGAAAGGG - Intergenic
1014780110 6:125555640-125555662 AAGGATATTTAGAAAGGAAAAGG - Intergenic
1014963961 6:127723171-127723193 ATGGATATAGAGAAAGTAGAGGG - Intronic
1015184338 6:130396740-130396762 AAAAATATACAGAGGAGAGAAGG + Intronic
1015661706 6:135582428-135582450 AAGGATATAAGGATGGGACAAGG + Intergenic
1015701949 6:136046237-136046259 AAATACATACAGAAGTGAGAAGG + Intronic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1017041134 6:150309327-150309349 AAGGAAAGACAGAAGGAAGGAGG + Intergenic
1017047191 6:150357671-150357693 AAGGAAATAGAGATGGCAGAGGG + Intergenic
1017065144 6:150521912-150521934 ATGTATATACAGAGGGGAAAAGG - Intergenic
1017168942 6:151437741-151437763 CAGGAGATACAGAATGGAGGTGG - Intronic
1017237323 6:152130172-152130194 TAGGATAAGCAGAAGAGAGAAGG + Intronic
1017638747 6:156469633-156469655 AAGAATATACACTAGGGAAAGGG + Intergenic
1018441559 6:163818541-163818563 AAGATTTTACAGAGGGGAGAAGG - Intergenic
1019877697 7:3829346-3829368 AAGGGCATACAGAGAGGAGAAGG + Intronic
1020350134 7:7210461-7210483 TAGGCCAGACAGAAGGGAGAAGG + Intronic
1020518551 7:9156720-9156742 ATGGATATACAGATAGGAGGTGG - Intergenic
1020685669 7:11290473-11290495 AAGGATATAGACAAGAGATATGG - Intergenic
1020811516 7:12855223-12855245 AAGGATGTACAAGAGGGAAAAGG - Intergenic
1020943257 7:14566839-14566861 AAGAATATACATAAGTGAGCTGG - Intronic
1021800496 7:24301031-24301053 AAGGATATACTCCAGGAAGAAGG - Intergenic
1022230396 7:28408397-28408419 AAGGAAATTCAGCAGGGGGATGG + Intronic
1022359971 7:29648588-29648610 CAGGATTTGAAGAAGGGAGAAGG - Intergenic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1024846755 7:53653566-53653588 ATAGACATACAGAAGGAAGAAGG - Intergenic
1024883648 7:54116990-54117012 CAGGTGATACAGAAGTGAGAGGG - Intergenic
1025320735 7:58090677-58090699 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1025553013 7:62273036-62273058 AGGGATCTTCAGGAGGGAGATGG + Intergenic
1025562380 7:62383406-62383428 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1025840778 7:65143821-65143843 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1025877935 7:65506342-65506364 AGGGATCTTCAGGAGGGAGATGG + Intergenic
1025882271 7:65552135-65552157 AGGGATCTTCAGGAGGGAGATGG + Intergenic
1025891171 7:65650467-65650489 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1026098752 7:67367700-67367722 AAGGAAAGACACAAGAGAGATGG + Intergenic
1026145973 7:67747081-67747103 GGGGATGTACAGAAGGGAGCAGG - Intergenic
1026381227 7:69801298-69801320 AAAAATAAACAGAAAGGAGATGG + Intronic
1027162571 7:75813387-75813409 AAGAACATGCAGCAGGGAGAGGG + Exonic
1029495062 7:100892146-100892168 AAGGAGACAGAGAAGGCAGAGGG - Intronic
1030128502 7:106177699-106177721 AAAGATGTACAGAAAGGGGAAGG - Intergenic
1030139651 7:106291784-106291806 AAGAAAATACAGATGGGAGGTGG - Intergenic
1030983817 7:116216602-116216624 AAATATATACATAAAGGAGATGG + Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032058999 7:128707939-128707961 AAGGAAGTAAGGAAGGGAGAAGG - Intergenic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032997917 7:137468923-137468945 ATGAATATACAGAGGTGAGAAGG + Intronic
1034044332 7:147912196-147912218 GAGGATACTCATAAGGGAGAAGG + Intronic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1036567458 8:9949671-9949693 AAAGACAGACAGACGGGAGAAGG - Intergenic
1036588207 8:10144612-10144634 AAGGAAAAAAAGCAGGGAGAGGG - Intronic
1037010773 8:13839574-13839596 AAGAAAATACAGAAAGGATAGGG + Intergenic
1037014485 8:13885717-13885739 TGGAATATAGAGAAGGGAGATGG + Intergenic
1037231937 8:16669664-16669686 AAGGATATAAACAAGGGGGTTGG + Intergenic
1038814754 8:30890478-30890500 AAGGAGATTGAGAAGGGAGTGGG - Intronic
1039003572 8:33008728-33008750 AAGGACAGACAGAAAAGAGATGG - Intergenic
1040051309 8:43017087-43017109 AAGGATGTGCAGAAGACAGAAGG - Intronic
1040582803 8:48711118-48711140 AAGGATAGACAGCTGGGACATGG - Intronic
1041411412 8:57560521-57560543 AAGGAGAAAGAGAAGGGAGGAGG - Intergenic
1041855257 8:62445559-62445581 ACAGTTATACAGAAGTGAGAAGG + Intronic
1042007347 8:64195973-64195995 AATGACATAGAGAGGGGAGAAGG + Intergenic
1042369962 8:67980433-67980455 AAGGATATGCAAAATGGAGGGGG + Intronic
1042567379 8:70125867-70125889 AAGGAAATAGAGAAAGGAGCTGG + Intronic
1042863918 8:73340235-73340257 AAAGATAAAAAGAAGGGAAAAGG + Intergenic
1043125608 8:76390623-76390645 AATGATATAGAGAAGTGTGATGG - Intergenic
1043132726 8:76481778-76481800 AAGGGACTAAAGAAGGGAGACGG - Intergenic
1043615429 8:82119204-82119226 ATGATTATGCAGAAGGGAGAAGG + Intergenic
1044424714 8:92037889-92037911 AACCATTTGCAGAAGGGAGAAGG - Intronic
1044962936 8:97548662-97548684 AAGTATATACAGAAAAAAGAGGG + Intergenic
1045062976 8:98424580-98424602 AAAGAAAAACAGAAGGCAGAGGG + Intronic
1045138516 8:99251136-99251158 AAAGGTATACAGATGGGAAATGG - Intronic
1045796055 8:106045602-106045624 AAGAATATGCAGAAGAGATATGG + Intergenic
1047128582 8:121991273-121991295 AAGGTTAAACTTAAGGGAGATGG + Intergenic
1047243481 8:123116883-123116905 AAAGATATAAATGAGGGAGAAGG + Intronic
1047398369 8:124524693-124524715 AAGGTTTTGCAGAAGGGGGAGGG + Intronic
1047701093 8:127450085-127450107 AATCATATATAGAAGGGAAAAGG + Intergenic
1048884925 8:138902249-138902271 AAGGATAAAGGGAAAGGAGAGGG - Intronic
1049909401 9:250856-250878 AAGCTTTTACAGAAGGGTGAGGG + Intronic
1050495192 9:6233436-6233458 GAGGAGATACAGAAGAGAGGGGG - Intronic
1050606154 9:7303525-7303547 AAGGAGAGGAAGAAGGGAGAGGG + Intergenic
1050948852 9:11562555-11562577 AAGGAAGGAAAGAAGGGAGAAGG - Intergenic
1051472615 9:17464494-17464516 AAGGATATCTCGAATGGAGAGGG + Exonic
1052973313 9:34393371-34393393 AAGGATATACTCTGGGGAGAAGG - Intronic
1053065280 9:35064295-35064317 GAGGAGATAAAGAAAGGAGAAGG + Intronic
1053613587 9:39741009-39741031 TAAGATATACACAAGGGGGAGGG + Intergenic
1053871628 9:42498966-42498988 TAAGATATACACAAGGGGGAGGG + Intergenic
1054239927 9:62601388-62601410 TAAGATATACACAAGGGGGAGGG - Intergenic
1054554060 9:66635914-66635936 TAAGATATACACAAGGGGGAGGG - Intergenic
1055101818 9:72473394-72473416 ATGGAAATACGGAAGGAAGAAGG + Intergenic
1055371181 9:75601352-75601374 AAGGAGAGAGAGAAGGAAGAAGG - Intergenic
1055499688 9:76890473-76890495 AAGTATATTCAGAAAGGAGTTGG + Intronic
1055522703 9:77097685-77097707 AAGAATATACAGAAAAGAGCTGG + Intergenic
1055852028 9:80643067-80643089 TAGGATATACAGAAGTAAGGTGG + Intergenic
1057752374 9:97803325-97803347 AAGGAGATGGGGAAGGGAGAAGG + Intergenic
1059263408 9:113002255-113002277 TAGGATATACAGAAGCAATACGG + Intergenic
1059747527 9:117217478-117217500 AAGGATACAAGGAAGGAAGAAGG - Intronic
1059925122 9:119201908-119201930 AAGGAAAAAAAGAAGAGAGAGGG - Intronic
1059977927 9:119737535-119737557 AAGGTCATACAGCAGGGAGCTGG - Intergenic
1060497769 9:124130660-124130682 AAAAATATACGGGAGGGAGAGGG + Intergenic
1060683297 9:125585010-125585032 AAGGTTCTATAGAAGGCAGAAGG + Intronic
1061232509 9:129322877-129322899 AAGGATAAAAAGGAGGGAGCGGG + Intergenic
1062257521 9:135635069-135635091 AAGGATAGAAGGAAGGAAGAAGG - Intronic
1203451051 Un_GL000219v1:117140-117162 AGGGACATAGAGAAGGGATAGGG - Intergenic
1203613655 Un_KI270749v1:30898-30920 AGGGATCTTCAGGAGGGAGATGG - Intergenic
1185708506 X:2282839-2282861 AGGGAGAGAGAGAAGGGAGAAGG + Intronic
1185999167 X:4989118-4989140 AAGGAAATAAGGAAGGCAGAGGG - Intergenic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186473114 X:9836520-9836542 AGGGAGAGAGAGAAGGGAGAAGG - Intronic
1188046680 X:25433155-25433177 AAGGAAATAAAAGAGGGAGAGGG + Intergenic
1189494377 X:41495827-41495849 ATGGAAATTCAGAAGGGTGAGGG - Intergenic
1190819812 X:53962931-53962953 AAGGATAGACTGCAGGGAGAAGG + Exonic
1190871635 X:54429743-54429765 CTGGTTATACAGATGGGAGAAGG - Intergenic
1190961911 X:55259727-55259749 CAAGATAAACATAAGGGAGAAGG - Intronic
1192106820 X:68325845-68325867 ATGGATATGGAGACGGGAGATGG - Intronic
1192902854 X:75518626-75518648 GAGTATATACACCAGGGAGATGG - Intronic
1192924219 X:75738510-75738532 AAGGATAAGGAGAAAGGAGAAGG - Intergenic
1193692477 X:84663488-84663510 GTGGATATTCAGAAGGGTGATGG + Intergenic
1194721628 X:97346988-97347010 AAGGAAACAGAGAAGGAAGAAGG - Intronic
1194946227 X:100071275-100071297 AAGGATTTTCAGACGGGGGAAGG - Intergenic
1195600216 X:106738550-106738572 ATGGAAATACACCAGGGAGAAGG - Intronic
1195710069 X:107766508-107766530 AAGCAGATACAAAAGGAAGAGGG + Intronic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196593993 X:117521953-117521975 GAGAATATATAGCAGGGAGAGGG - Intergenic
1197517381 X:127450603-127450625 AAGGAGATTCTGAAGGGTGAAGG + Intergenic
1197777096 X:130125581-130125603 AAGGACGTACAGAAGGGATATGG + Intergenic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1198849674 X:140953000-140953022 AAGGAAATACGGAAGTGAAAAGG + Intergenic
1198856508 X:141022770-141022792 AAGGACATAAAGAAAGAAGAAGG + Intergenic
1198906184 X:141564597-141564619 AAGGACATAAAGAAAGAAGAAGG - Intergenic
1200960203 Y:8989482-8989504 ATGGAGAGCCAGAAGGGAGATGG - Intergenic
1201697389 Y:16840952-16840974 AAGGAAAAATAGAAGGAAGAAGG + Intergenic