ID: 982149449

View in Genome Browser
Species Human (GRCh38)
Location 4:152436593-152436615
Sequence CTGTCCAGCTAGAAGAGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982149449_982149451 9 Left 982149449 4:152436593-152436615 CCATGACTCTTCTAGCTGGACAG 0: 1
1: 0
2: 1
3: 17
4: 161
Right 982149451 4:152436625-152436647 ATACCTGCCTTCCAAACTAAAGG No data
982149449_982149453 14 Left 982149449 4:152436593-152436615 CCATGACTCTTCTAGCTGGACAG 0: 1
1: 0
2: 1
3: 17
4: 161
Right 982149453 4:152436630-152436652 TGCCTTCCAAACTAAAGGACAGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982149449 Original CRISPR CTGTCCAGCTAGAAGAGTCA TGG (reversed) Intronic
901941006 1:12661646-12661668 CTGTCCAGGCAGAGGAGGCAAGG + Intronic
905534784 1:38712726-38712748 CAGTCAGGCTAGAAGAGTCCTGG + Intergenic
905772657 1:40648337-40648359 CAGTCCAGCCGGGAGAGTCAGGG - Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
908710153 1:67005867-67005889 CTGTACAGCTAAAAGAATTAAGG - Intronic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
913602413 1:120434172-120434194 CTGCACAGCTAGCAGAGTCGTGG - Intergenic
914084636 1:144442465-144442487 CTGCACAGCTAGCAGAGTCGTGG + Intronic
914190645 1:145407631-145407653 CTGCACAGCTAGCAGAGTCGTGG + Intergenic
914363585 1:146957778-146957800 CTGCACAGCTAGCAGAGTCGTGG - Intronic
914488091 1:148129356-148129378 CTGCACAGCTAGCAGAGTCGTGG + Intronic
914588452 1:149084475-149084497 CTGCACAGCTAGCAGAGTCGTGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
920283091 1:204858817-204858839 CTTTCCAGAAAGAAGAGTCAGGG - Intronic
924484636 1:244468967-244468989 CTTTTCATCAAGAAGAGTCACGG - Intronic
1065758007 10:28951988-28952010 CTGTCAGGCTAGAAGAGTAGGGG + Intergenic
1068688765 10:59894938-59894960 CTGTTCAGTTAGGATAGTCAGGG - Intronic
1069106249 10:64386287-64386309 CTGTACAGCCTGAAGAATCATGG - Intergenic
1069987299 10:72293164-72293186 CTGTCCAGGGAGACCAGTCAAGG + Intergenic
1070285124 10:75077432-75077454 ATGTCCAGCTAGTAGAGACGGGG + Intergenic
1074658714 10:115625557-115625579 CTTTCCAGATAGAATATTCATGG - Intronic
1074972342 10:118549530-118549552 CTGTTTAACTAGAAGAGACATGG - Intergenic
1076067179 10:127458251-127458273 CTGTGCTGCTAGAACAATCAAGG + Intergenic
1076337434 10:129717739-129717761 CTGTCCTCAGAGAAGAGTCAGGG - Intronic
1077961296 11:7078998-7079020 CTTTCCAACTAGAAAGGTCAGGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087279472 11:96194139-96194161 CTGGCCAGCTATTAGAGTCTCGG - Intronic
1088731939 11:112690958-112690980 CTGTCCAGCAAGAAAGGTCTAGG - Intergenic
1088804061 11:113334878-113334900 CTATACAGCTAAAAGAGTTAAGG - Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090466833 11:126942541-126942563 CCCTCCAGCTGGAAGAGCCAGGG - Intronic
1091852004 12:3707048-3707070 CTGTCCAGCTGGGGGAGTCAAGG - Intronic
1092204813 12:6608205-6608227 CTGTGGAGCTAGAAGAGGGAAGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097812831 12:64036911-64036933 CTGTCCTGTAAGAAGAGCCAGGG - Intronic
1100002368 12:89852942-89852964 GTGACCAAGTAGAAGAGTCAAGG - Intergenic
1100645313 12:96523087-96523109 ATATCCATCTAGAACAGTCAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101686121 12:107023631-107023653 CTGTACAGCTTGAAGAGTCAAGG + Intronic
1102215156 12:111155985-111156007 CAGTCCAGCTGGAAAAGCCAGGG - Intronic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1112186237 13:97130482-97130504 CTGTTCAGCTGGAAGAAACAGGG + Intergenic
1113644076 13:111980034-111980056 CTATCAAGGTAGAATAGTCAGGG + Intergenic
1115834226 14:37379724-37379746 CTTTCCATTTACAAGAGTCAAGG - Intronic
1116250017 14:42469913-42469935 CTGTCCACCTAGAAGTGGCATGG + Intergenic
1118349790 14:64965564-64965586 CTGACCAGAGAGAAGAGCCAAGG + Intronic
1118453645 14:65926526-65926548 CTGCCCAGCTCTAAGAGCCAGGG - Intergenic
1120509998 14:85401695-85401717 CTTTCCAGCTAGAAGCCTCAGGG + Intergenic
1127696960 15:61459551-61459573 CTCTCCAGCTAGTTCAGTCAAGG + Intergenic
1128114506 15:65096837-65096859 CAGAGCAGCTAGAAGAGTCAGGG - Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1133516659 16:6515901-6515923 CATTCCATCTAGGAGAGTCAAGG - Intronic
1138944641 16:61833950-61833972 CTGTCCTGCTAGCAAAGTAATGG + Intronic
1139969418 16:70764451-70764473 CTGTGCAGGTAGAGGAGTCTAGG + Intronic
1144212225 17:13025429-13025451 CTGTCCAGGGAGAAGGGTGAGGG + Intergenic
1146748300 17:35352134-35352156 CTTTCTGGCTGGAAGAGTCAGGG + Exonic
1147423077 17:40332156-40332178 CTGGCCAGCTGGCAGAGTCCAGG + Intronic
1148811000 17:50291154-50291176 CTTTCCAGGTAAAAAAGTCAAGG - Intergenic
1150497652 17:65620905-65620927 CTGTTCAGCAAGAAGGGTGAGGG + Intronic
1151506621 17:74532086-74532108 CTGCCCAGCTCTAAGAGCCAGGG - Intergenic
1151965075 17:77426898-77426920 CTGTCCAACTGGAGCAGTCAGGG + Intronic
1152365928 17:79856258-79856280 CTGTCCAGCTCGAAGTGAGAGGG - Intergenic
1154973583 18:21435251-21435273 CCTTCCAACCAGAAGAGTCAGGG + Intronic
1157800133 18:50612793-50612815 CTGTCTAGTTAGAAGATTCTAGG - Intronic
1158250038 18:55477633-55477655 CTGTCCTGCTAGCAAAGTCCTGG - Intronic
1160404345 18:78634911-78634933 CTGTGCAGCTGTGAGAGTCATGG - Intergenic
1161388324 19:4008336-4008358 CCGTCCAGGTGGAGGAGTCAGGG + Intronic
1163117715 19:15198245-15198267 CTGTCCTGCCAGAAGGGTCCAGG + Intronic
1164818268 19:31223823-31223845 CGCTCCAGCTAGGACAGTCAAGG - Intergenic
1165245545 19:34496560-34496582 CTGAGCAGCTGGAGGAGTCAGGG + Intronic
1165543947 19:36517613-36517635 CTGTCCAGCTAGGAGAGTTCAGG - Intronic
1167263319 19:48470757-48470779 CTGTCCACCTAGAATAGACCCGG - Intronic
925532143 2:4875886-4875908 TTGTCCAGCTGGTAGAGTAATGG - Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
926756789 2:16242979-16243001 CTGTAAAGCCAGAAGAGACAGGG - Intergenic
932409155 2:71535006-71535028 CTGCACAGCTAGAAGACACAGGG - Exonic
933021774 2:77203322-77203344 CTGTCCATCTCCAGGAGTCAAGG - Intronic
933385490 2:81605738-81605760 GTGTCTAGGTAGAAGAGTCATGG - Intergenic
937236138 2:120432877-120432899 CTGTGAAGCTAGAAGTCTCAGGG + Intergenic
941226178 2:162851440-162851462 CTGTTAAGCTAGAAGTGCCAGGG + Intergenic
941545315 2:166842834-166842856 CTCTTCATCTTGAAGAGTCAGGG + Intergenic
947148307 2:227088608-227088630 CTTTCCAGTTAAAAGAGACATGG - Intronic
1171205098 20:23272923-23272945 CTGTGAATCTAGAAGAGTTATGG - Intergenic
1171297953 20:24035119-24035141 CTGTCCACCTTGCTGAGTCATGG - Intergenic
1174110577 20:48195236-48195258 CTGTCCTGTTTGCAGAGTCAAGG + Intergenic
1174389331 20:50208179-50208201 CTGTCCAGCCCGGAGAGTCCAGG - Intergenic
1175976025 20:62710927-62710949 CTGCCCAGCTAGAGGGGCCAGGG + Intronic
1176247727 20:64105354-64105376 CTGTCCAGGAAGCAGAGACATGG + Intergenic
1180246148 21:46548707-46548729 GTGTCCAGATAGCAGACTCAAGG + Intronic
1181527981 22:23501030-23501052 CTGTCCAGCCTGAAGAGTGGGGG + Intergenic
1183015532 22:34983498-34983520 CTGTATAGCTTGAAGAGGCAGGG - Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1184425549 22:44407129-44407151 CTGTCCAGGGAGAACAGGCAGGG + Intergenic
1185185479 22:49396854-49396876 GTGTCCAATTGGAAGAGTCATGG + Intergenic
1185255993 22:49831897-49831919 CTGTCCAGATTCAAGAGTTAGGG + Intergenic
949271504 3:2223196-2223218 TTGTCCACCTAGAACAGTAAAGG - Intronic
949629389 3:5906433-5906455 CTGTCTAGCTAAAACAATCAAGG - Intergenic
949689223 3:6615413-6615435 CTGTCCTCCTAGAATACTCATGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952660231 3:35837169-35837191 CTCTCTAGCTAGGAGAGTCCTGG + Intergenic
961134661 3:124498882-124498904 CTGGCCATCTAGTATAGTCAGGG - Intronic
965123285 3:164591497-164591519 CTGTCCAGTCAGAAGATTAAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973781166 4:54289379-54289401 GTGTGCAGTTAGAAGACTCAGGG + Intronic
974517306 4:62934614-62934636 CTCTCTAGTTAGGAGAGTCAGGG + Intergenic
976324347 4:83753533-83753555 CAGTTCAGCTAGAAGATCCAGGG - Intergenic
977251178 4:94691459-94691481 CTGCCCACCTAGAGAAGTCAGGG - Intergenic
982149449 4:152436593-152436615 CTGTCCAGCTAGAAGAGTCATGG - Intronic
982865920 4:160511775-160511797 TTGGCAAGCTAGAAGAGCCAAGG + Intergenic
982907338 4:161091189-161091211 CTGTTCTGATGGAAGAGTCAGGG - Intergenic
987405411 5:17519201-17519223 CTTTCCAGCTGGAGGAATCAAGG + Intergenic
987405856 5:17522635-17522657 CTTTCCAGCTGGAGGAATCAAGG + Intergenic
987406304 5:17526069-17526091 CTTTCCAGCTGGAGGAATCAAGG + Intergenic
987406752 5:17529503-17529525 CTTTCCAGCTGGAGGAATCAAGG + Intergenic
987407394 5:17584902-17584924 CTTTCCAGCTGGAGGAATCAAGG - Intergenic
987408096 5:17590104-17590126 CTTTCCAGCTGGAGGAATCAAGG - Intergenic
987408540 5:17593538-17593560 CTTTCCAGCTGGAGGAATCAAGG - Intergenic
987408996 5:17596972-17596994 CTTTCCAGCTGGAGGAATCAAGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989529063 5:42485538-42485560 CTACCCAGTTAGAAGAGTTATGG + Intronic
989809233 5:45652808-45652830 CTGGGCAGAGAGAAGAGTCAGGG - Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993523360 5:88933504-88933526 CTGTCCAGGTAGAAGAATAAAGG - Intergenic
997719065 5:136063724-136063746 CTGTCCAGGTAGAAAAGAAATGG + Exonic
1000038561 5:157467577-157467599 TTTTCCACCTAAAAGAGTCAGGG - Intronic
1000125218 5:158237291-158237313 ATTTCCAGCTAGAAGGCTCAGGG - Intergenic
1000288174 5:159846084-159846106 ATGTGGACCTAGAAGAGTCAGGG - Intergenic
1001887812 5:175311365-175311387 CTGTCCAGCGAGGATAGTGAGGG - Intergenic
1002418445 5:179132932-179132954 ACGTCCTGCTAGTAGAGTCAGGG + Intronic
1002870651 6:1164676-1164698 CTGTCCAGATGAAAGCGTCATGG - Intergenic
1005956805 6:30669916-30669938 CTGTCCAGTGAGAAGACACAGGG + Intronic
1007386741 6:41525106-41525128 CTTTCCTGCTAGAACACTCAGGG - Intergenic
1010773871 6:79863147-79863169 CTCTCCAGCTAGGAGAGTGGAGG - Intergenic
1010959618 6:82130746-82130768 CTGACCATGTAGTAGAGTCATGG + Intergenic
1012427344 6:99129076-99129098 CTCTGCAGCTGGCAGAGTCAGGG + Intergenic
1013983735 6:116165163-116165185 CTGACAAGCCAGAAGAGACAGGG - Intronic
1014008543 6:116449911-116449933 CTTTCAAGCTAGAAAACTCAGGG - Intergenic
1014887575 6:126800358-126800380 CTTGCCAACTAGAAGAGGCATGG - Intergenic
1016519331 6:144929189-144929211 CTAGCCAGAGAGAAGAGTCAGGG + Intergenic
1018341935 6:162859955-162859977 CTCACCAGCTACAAGAGTCATGG - Intronic
1018424385 6:163667377-163667399 CTGGCCTGTGAGAAGAGTCAAGG - Intergenic
1022358538 7:29638435-29638457 CTCGACAGCTAGAGGAGTCAGGG + Intergenic
1028939378 7:96503846-96503868 TTCTTCAGCTAGAAGAGTAAGGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031085498 7:117298158-117298180 GTGGCCAGTTAGAAGAGTGAGGG + Intronic
1031247703 7:119337730-119337752 CTATCCAGCTAAAACAGTAAGGG - Intergenic
1032188081 7:129744896-129744918 CTGCTCAGATAGAAGAGGCAGGG + Intronic
1034254385 7:149716321-149716343 CTGCCCAGTTACAAGAGTCCTGG + Intronic
1035104430 7:156430119-156430141 GGGTCCAGCGAAAAGAGTCATGG - Intergenic
1035754378 8:2020868-2020890 CTGCCCCGCTAGGAGAGTCCCGG - Intergenic
1037127161 8:15365416-15365438 CTCTCCAGTTAGAGGAGCCAAGG + Intergenic
1037390755 8:18389079-18389101 ATGTCCAGCAAGAACCGTCATGG - Intergenic
1037958997 8:23082413-23082435 CTGTCCTGCTGGGACAGTCATGG + Intergenic
1041887790 8:62831817-62831839 CTGACCATCTAGCAGAGTTAAGG - Intronic
1043000763 8:74756951-74756973 CTGGCCAGCTAGAAGGATCAGGG + Exonic
1043402511 8:79897948-79897970 CTGGTCAGCTAGAATAGTGAGGG - Intergenic
1046632764 8:116637967-116637989 CTTCCCAGCTGGAACAGTCAAGG + Intergenic
1046771158 8:118118061-118118083 CTTTCCAGCTGAAATAGTCAAGG + Intergenic
1048179040 8:132178759-132178781 CTGTCCAGCTACAGGTGGCATGG + Intronic
1049344458 8:142131076-142131098 CAGTGCAGAGAGAAGAGTCAGGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052728833 9:32261996-32262018 CTGCCCAGCTAGAGGAGGCAGGG + Intergenic
1053514061 9:38714740-38714762 CTGTTCATTTAGAAGTGTCAAGG + Intergenic
1055868021 9:80839535-80839557 CTGTCTTGATAGCAGAGTCAAGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056921076 9:90789652-90789674 GTGCCCTGCTAGTAGAGTCAGGG + Intergenic
1058544496 9:106046139-106046161 CTATCCTGCTAGCAGAGTCATGG - Intergenic
1059696197 9:116732537-116732559 CTGCCCAGGGAGAATAGTCACGG - Intronic
1060778307 9:126392855-126392877 CTGTGCAGCTGGAAGAGCCAGGG + Intronic
1061800089 9:133108984-133109006 CTGTCCAGCTAAAAGAACCAAGG + Intronic
1061929441 9:133824861-133824883 CTGTCCAGCGAGAGGGCTCAGGG + Intronic
1062729524 9:138101362-138101384 CCAGCCAGCTAGAAGGGTCAGGG - Intronic
1187234695 X:17456281-17456303 TTGTTCATCTAGAAGAGTCTGGG + Intronic
1189423685 X:40879780-40879802 CTGACAAGCTGGAAGTGTCAAGG - Intergenic
1190431527 X:50382343-50382365 CTGTCCCGCTAGACTAGTCTTGG + Intronic
1197412525 X:126137168-126137190 CTGTCTTGCTAGAAAGGTCAAGG - Intergenic
1200259116 X:154602555-154602577 CTGTCCAGCTCAAAGACTCCAGG + Intergenic