ID: 982150898

View in Genome Browser
Species Human (GRCh38)
Location 4:152455951-152455973
Sequence GGTAACATATATACAGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 1, 2: 3, 3: 55, 4: 314}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982150898 Original CRISPR GGTAACATATATACAGCTTT TGG Intronic
901263704 1:7892913-7892935 GGTAAAATATTCACAGTTTTTGG + Intergenic
902567354 1:17321007-17321029 GGTAACATCTTCACAGGTTTGGG + Intronic
903655171 1:24944481-24944503 GGTAACATAGCCACAGGTTTGGG - Intronic
904201803 1:28824662-28824684 GATAATATATATACATCTCTAGG - Intronic
904281494 1:29423584-29423606 TACAACATATATACAGCTTCAGG - Intergenic
905392023 1:37642339-37642361 GGTAACATATTCACAGGTTTGGG + Intergenic
906548999 1:46645793-46645815 GTTAACATCTATCCAGCATTTGG + Intronic
906793589 1:48679173-48679195 GGTAACATTTGTACAGATTGTGG + Intronic
906857791 1:49327208-49327230 GGTAACATATTTAAAGGCTTTGG + Intronic
907580558 1:55568510-55568532 GGTCACATATTCACAGGTTTTGG - Intergenic
907785889 1:57612320-57612342 GGTAACATAATCACAGGTTTTGG - Intronic
908724973 1:67165660-67165682 GGTAACATAGATGCAACTTGAGG + Intronic
908897976 1:68922802-68922824 GGTAACATATTCACAGGTTCTGG - Intergenic
909116874 1:71548308-71548330 GGTAACATTTCTGCTGCTTTGGG + Intronic
909480055 1:76121175-76121197 AGTAACATATTCACAGGTTTTGG + Intronic
909600753 1:77458807-77458829 AGTAACATATTCACAGCTTCTGG + Intronic
909644727 1:77904342-77904364 CATTAAATATATACAGCTTTTGG - Intronic
909726710 1:78845348-78845370 GGTAACATATTCACAGATCTGGG - Intergenic
910593353 1:88951821-88951843 GGTAACATATTTACAAGTTCTGG - Intronic
912149001 1:106833172-106833194 GGTAAGTTATATTCAGCTTTTGG + Intergenic
913478315 1:119260365-119260387 GGTAACATGTTTACAGGTTCTGG + Intergenic
916066444 1:161139874-161139896 GGTAACATTTATCCAGCACTAGG - Intergenic
916852651 1:168719265-168719287 GGCAAAATAAATATAGCTTTGGG + Intronic
917083633 1:171283137-171283159 GGTAACTTATTTACACCTGTAGG - Exonic
917129836 1:171729835-171729857 GGTAACACATTCACAGGTTTTGG - Intronic
917169057 1:172149215-172149237 CATAAAATATATACTGCTTTTGG - Intronic
917233258 1:172861345-172861367 GGAAACATATTCACAGGTTTGGG - Intergenic
917870211 1:179234787-179234809 GGTAACATTTATACAGCACTTGG - Intergenic
918191391 1:182178284-182178306 GGTGACATATTTACAGGTTTTGG - Intergenic
918723458 1:187885762-187885784 GGGTACATAGTTACAGCTTTAGG + Intergenic
919950253 1:202356478-202356500 GGTAACATATTTACATGTTCTGG - Intronic
921254020 1:213323280-213323302 GGTAACATATTCACAAGTTTTGG + Intergenic
923611125 1:235495288-235495310 GATAACATGTATAAAGCTCTTGG + Intronic
923788390 1:237090279-237090301 AGTAACATATTTACAGGTTCTGG - Intronic
924320611 1:242844864-242844886 CGTAAAATATGTATAGCTTTGGG - Intergenic
1063736561 10:8762067-8762089 TGTAACATATTTATGGCTTTTGG + Intergenic
1063989154 10:11541364-11541386 GGTAATATACATAAAGCATTTGG - Intronic
1065062125 10:21913190-21913212 GGTAAAAAATTTACAACTTTAGG + Intronic
1065900975 10:30207679-30207701 GCTATCATATATATAGCCTTGGG + Intergenic
1066061486 10:31727464-31727486 GGTAACATATTCACAGATTCTGG - Intergenic
1066191562 10:33060844-33060866 GGTAACATATTCACAGGTTCCGG - Intergenic
1068043431 10:51856254-51856276 GGTAACATATTTACAGGTTCCGG + Intronic
1071581276 10:86772911-86772933 GGTAACATCTATAAACATTTTGG + Intronic
1071713065 10:88068582-88068604 GGTAACATATTCACAGGTTCTGG + Intergenic
1071791234 10:88956551-88956573 GGTAACATATCCACAGGTTTAGG + Intronic
1071935833 10:90529134-90529156 GGTAACATATTCACAGGTTCTGG + Intergenic
1072832867 10:98677520-98677542 GGTAACATATGAAAAGCGTTTGG - Intronic
1073248815 10:102109318-102109340 GGAAATAAAGATACAGCTTTGGG + Intronic
1074425083 10:113343549-113343571 GGTAACATATTCACAGGTTCTGG - Intergenic
1074494069 10:113963654-113963676 GGTAACATATTCACAGGTTCCGG + Intergenic
1075024610 10:118975405-118975427 GGTAACATATTCACAGGTCTTGG + Intergenic
1075678112 10:124310884-124310906 GATAATAAAAATACAGCTTTTGG + Intergenic
1078388609 11:10915273-10915295 GGTAACATATATACGGGTTCAGG + Intergenic
1078715948 11:13839128-13839150 GGTAGCATATTCACAGATTTGGG + Intergenic
1079022129 11:16917720-16917742 GGTAACATATTCACAGGTTCTGG + Intronic
1080612127 11:33913728-33913750 GGTAACAAATGTATAGCTTCTGG - Intergenic
1081677944 11:44981859-44981881 GGTAACATATTCACAGGTTCTGG + Intergenic
1083426900 11:62592801-62592823 GGTAACATGTATACCCCCTTGGG - Intergenic
1083983210 11:66191384-66191406 GGTACCATATTCACAGGTTTTGG + Intronic
1085356310 11:75841020-75841042 GGTAACAAATATAAACCTGTGGG - Intronic
1086585910 11:88450728-88450750 GGGAACATATTCACAGGTTTTGG - Intergenic
1087232490 11:95681969-95681991 GTTAACATATTCACAGATTTGGG + Intergenic
1087547072 11:99598171-99598193 GGTAGCATGGATACAGTTTTAGG - Intronic
1087995487 11:104802096-104802118 GGTCACATATTTACAGTTTCTGG - Intergenic
1088090406 11:106032080-106032102 GGTAACATATTTACATGTTTTGG - Intergenic
1088966580 11:114728282-114728304 GGTAGCATATTTACAGATCTGGG + Intergenic
1091689083 12:2583553-2583575 GGTAACATAGGAACAGCTCTGGG + Intronic
1092132447 12:6122048-6122070 TATAGCATATATACAGCTGTGGG + Intronic
1093337357 12:17921952-17921974 AATAACATATATACATCTTCAGG + Intergenic
1093404906 12:18792398-18792420 GGTAACAGATCCACAGGTTTGGG + Intergenic
1093554980 12:20461634-20461656 GGTAATGTATATTAAGCTTTGGG + Intronic
1094081818 12:26545196-26545218 GGTAACATGTTTACAGGTTCTGG - Intronic
1095865667 12:46969299-46969321 GGTAACATATTCACAGGTTCTGG + Intergenic
1098084730 12:66830229-66830251 GGTAACATATTCACAGGTTCTGG - Intergenic
1098445955 12:70565778-70565800 GGTAACATATTCACAGGTTCTGG - Intronic
1098571903 12:71997353-71997375 GGTAACATATTCACAGGTTCTGG + Intronic
1102447842 12:113017240-113017262 GGTAACATATTCACAGGTTCTGG + Intergenic
1102926061 12:116827354-116827376 GCTAACATCTATTCATCTTTTGG - Intronic
1102975047 12:117200807-117200829 GGTAACATATTCACAGTTCTCGG - Intergenic
1103163351 12:118749576-118749598 GGTAACAGATATACAACTGGGGG - Intergenic
1104099245 12:125590635-125590657 GGCAATATATAAACAGCTTTGGG + Intronic
1104532717 12:129587584-129587606 CGTTCCATATTTACAGCTTTGGG - Intronic
1106434745 13:29713433-29713455 GGGAACATATAGAAAGGTTTTGG + Intergenic
1107000259 13:35535899-35535921 GGTAACATTCATACTGCCTTAGG + Intronic
1107638663 13:42418882-42418904 GGTATCATTTATACAAATTTTGG + Intergenic
1108150152 13:47525048-47525070 GGTAACATTTCTACAGGTTCTGG + Intergenic
1109590215 13:64469668-64469690 AGTAATAAATATACAGTTTTAGG + Intergenic
1109796509 13:67320631-67320653 GGTAACGCATTTACAGGTTTCGG + Intergenic
1109823485 13:67687746-67687768 TGTAACATATTCACAGGTTTAGG + Intergenic
1110676754 13:78256939-78256961 GGCAACATATTTACAGGTTTGGG + Intergenic
1111235933 13:85407542-85407564 GATAACATATGTACATTTTTTGG + Intergenic
1111387192 13:87542027-87542049 GGCAACTTATAAACAGCATTGGG + Intergenic
1111587683 13:90303885-90303907 GGTAACATATTCTCAGGTTTGGG - Intergenic
1111701815 13:91699338-91699360 GGTAGCTTATATACAACCTTTGG - Intronic
1111729564 13:92056420-92056442 GGTAACATACTCACAGGTTTTGG + Intronic
1111926321 13:94467119-94467141 GGTTACATAAATACTGCATTAGG - Intronic
1112806209 13:103166206-103166228 TGTAACATATGTACACATTTTGG + Intergenic
1114808227 14:25862964-25862986 GGTAAAATATTTACTGCATTGGG - Intergenic
1115795942 14:36935777-36935799 GGGACCATATATACACTTTTGGG - Intronic
1116712546 14:48386649-48386671 GGTAACATATTGACAGGTTTGGG + Intergenic
1116976402 14:51120874-51120896 GCTAACATATATAAAGCACTTGG + Intergenic
1117528576 14:56636836-56636858 GGTAACATATTCACAGGTTGTGG - Intronic
1117594074 14:57308444-57308466 GGTAACATATTGACAGTTTTTGG - Intergenic
1118009256 14:61592602-61592624 GGTAACATATTCACAGGTTTTGG + Intronic
1119045276 14:71313508-71313530 GGTAACATATTCACAGGTTTTGG + Intergenic
1119141880 14:72274550-72274572 GGTAACATATGCACAGGTTCTGG - Intronic
1119540880 14:75437615-75437637 GGCAACATGTATTCAGCCTTTGG - Intronic
1121340338 14:93101212-93101234 GGTCACACATGTAGAGCTTTGGG - Intronic
1121856614 14:97276212-97276234 GGTCACATATTCACAGGTTTGGG - Intergenic
1124205036 15:27710693-27710715 GGTAACATATTCACAGGTTCTGG - Intergenic
1124694759 15:31854731-31854753 GGTAACATATTCACAGGTTTGGG + Intronic
1124801418 15:32836570-32836592 TGTAAGACATATACAGCTTAGGG - Intronic
1125847252 15:42868392-42868414 TGTAACAAATGTACAGCTGTGGG + Intronic
1126158387 15:45586388-45586410 GCTAACATATTCACAGCTTCTGG + Intergenic
1126389452 15:48130901-48130923 GGTAAAATAAAAACAGCATTGGG + Intronic
1126532055 15:49721459-49721481 GGTAACATATTCACAGGTTCTGG - Intergenic
1127719981 15:61689668-61689690 CAAAACAAATATACAGCTTTGGG - Intergenic
1127918257 15:63472973-63472995 GGTAACATATAAAAATCTTGGGG - Intergenic
1128483534 15:68061180-68061202 CGTTACATAAATACAGATTTAGG - Intronic
1130219432 15:82006675-82006697 GGTAATATATTCACAGGTTTAGG - Intergenic
1130404325 15:83584402-83584424 AGTAACATATTTGCAGGTTTGGG + Intronic
1130834837 15:87640078-87640100 GGTAACCTCTATACAGATTGAGG - Intergenic
1131771519 15:95742905-95742927 GGTAACATATTCACAGGTTCCGG + Intergenic
1132155047 15:99489710-99489732 GGTAACATATTCACAGGTTCTGG + Intergenic
1133788757 16:8993034-8993056 GGTAACATATGCACAGGTTCTGG - Intergenic
1134371824 16:13633109-13633131 GGTAACATATTCACAGGTTCTGG - Intergenic
1136266513 16:29123271-29123293 GTTTACATACATACAACTTTGGG + Intergenic
1138487622 16:57356939-57356961 GGTAACATATTCATAGGTTTTGG + Intergenic
1138620024 16:58203552-58203574 GGTAACATATTTACAGATTCTGG - Intergenic
1140287557 16:73619144-73619166 ATTAACATTTATATAGCTTTGGG - Intergenic
1140429246 16:74887617-74887639 GGTTACATATGCACAGCTCTGGG + Intronic
1141020458 16:80491171-80491193 AGGAACATATAAACAGCTTAGGG - Intergenic
1141066382 16:80917194-80917216 GATAACATATTTGCAGGTTTGGG + Intergenic
1141372669 16:83502139-83502161 GGTAACATATTTACAAGTTCTGG - Intronic
1143932039 17:10439006-10439028 GTTAAAATATACACTGCTTTAGG + Intergenic
1146078293 17:29753863-29753885 TTTAACATATATACAACATTAGG + Intronic
1146781061 17:35672921-35672943 GGATACAAATATACAGCTATGGG - Intronic
1148397085 17:47317657-47317679 GGTAACATATTCACAGGTTCTGG - Intronic
1148841595 17:50502229-50502251 GGTAACATATTTACAGCTTCCGG + Intergenic
1149903662 17:60505621-60505643 GGTAACATTAATAAAGATTTTGG - Intronic
1150793418 17:68218948-68218970 GGTTACATATAGACCACTTTAGG - Intergenic
1155341052 18:24814505-24814527 GGTAACATATTGACAGGTTCTGG + Intergenic
1155445276 18:25905020-25905042 AGCAACATATATACATGTTTAGG + Intergenic
1156417486 18:36912521-36912543 TGTAACATATTTGCAGGTTTTGG + Intronic
1156509769 18:37626578-37626600 GGGAACATATTCACAGGTTTGGG + Intergenic
1157001981 18:43537801-43537823 GGTAACATATATATAGTTACTGG - Intergenic
1159452835 18:68624367-68624389 GGTAGCATAGTCACAGCTTTTGG - Intergenic
1159708919 18:71729353-71729375 GTTAACATATATACAGTTGAGGG - Intergenic
1161225149 19:3141033-3141055 GGTAAAAAAAAAACAGCTTTTGG - Intronic
925079001 2:1046056-1046078 GGTTGCATATATACATATTTAGG + Intronic
925666235 2:6259534-6259556 GGGAACACAGATTCAGCTTTAGG + Intergenic
926637672 2:15200189-15200211 CATAACAAATATCCAGCTTTTGG - Intronic
926680263 2:15657813-15657835 GGTAGCATATTTACAGCTCTAGG + Intergenic
926720749 2:15958424-15958446 GTTTACATATATTTAGCTTTTGG + Intergenic
926821077 2:16852198-16852220 GGTAACATATGCACAGTTTCTGG + Intergenic
927059413 2:19401451-19401473 GATAACATATTTACAGGTTATGG + Intergenic
927470588 2:23373076-23373098 GGTAACATATACACAGCTTTGGG - Intergenic
928777352 2:34781501-34781523 GGTAACATATTGACAGATTCTGG - Intergenic
930035369 2:47082026-47082048 GGTAACATATTCACAGGTTCTGG - Intronic
930530222 2:52580413-52580435 GGGAACATATTTCCAGCATTTGG - Intergenic
930798379 2:55417583-55417605 GATAACATATATATTTCTTTGGG + Intronic
931049440 2:58394184-58394206 GGTAACATATTAACAGGTTCTGG - Intergenic
931451518 2:62370962-62370984 GGTAACATATTCACAGGTTTGGG - Intergenic
936135335 2:109888203-109888225 AGTAACATATTCACAGGTTTTGG - Intergenic
936209362 2:110483282-110483304 AGTAACATATTCACAGGTTTTGG + Intergenic
936240978 2:110788632-110788654 GGTAAAATACATACAGCATAAGG - Intronic
936428548 2:112438521-112438543 AGTAACATATTCACAGGTTTTGG + Intergenic
936502279 2:113075473-113075495 GGTAACATATGCACAGATCTTGG - Exonic
938803256 2:134782762-134782784 GGTAACATATTCACAGGTTCTGG + Intergenic
939389273 2:141545423-141545445 GGTAACATATTCACAGGTTCTGG - Intronic
939651587 2:144769165-144769187 TGACACATTTATACAGCTTTTGG - Intergenic
940138530 2:150466261-150466283 GGTAACTTATTTACAACTTTAGG - Intergenic
940818194 2:158319983-158320005 GGTAACATGGAGACAGATTTTGG - Intronic
941964261 2:171285031-171285053 GGTCTTATATACACAGCTTTAGG + Intergenic
942654086 2:178196029-178196051 GGAAACATTTCTACAGTTTTGGG + Intronic
942944839 2:181660586-181660608 GGTAACATATTCACAGGTTCTGG + Intronic
943804052 2:192099869-192099891 GAAAAAATATAGACAGCTTTTGG + Intronic
943918252 2:193666287-193666309 GCTAACATATTAACAGGTTTTGG + Intergenic
944361002 2:198856438-198856460 GGCAACATATATACAGCTGGAGG + Intergenic
944824391 2:203467087-203467109 GGAAAGATATAAACAGCTTAAGG + Intronic
944931885 2:204528359-204528381 GGTAACATATTCACAGGTTCTGG - Intergenic
945029867 2:205653166-205653188 GGTAACATATTCACAGAATTTGG - Intergenic
945082614 2:206101208-206101230 GGTAACATATTCACAGGTTTAGG + Intergenic
945101405 2:206265424-206265446 GTTAACAAATATTCAGCTTTTGG + Intergenic
945810918 2:214549266-214549288 GGTGACATATTTACAGGTTGTGG + Intronic
947258118 2:228189057-228189079 GGTAACATATTCACAGGTTTTGG + Intergenic
1169029003 20:2393917-2393939 GGGAAAATAAATACAGGTTTAGG - Intronic
1169401943 20:5289515-5289537 GGTAACATATTGACAGGTTCTGG + Intergenic
1172608746 20:36233440-36233462 GGGAACATATATAGAGGTTCTGG - Intergenic
1173024535 20:39295717-39295739 CATAAAAGATATACAGCTTTGGG + Intergenic
1173428275 20:42961734-42961756 GGTAGCATATACACAGGTTCTGG - Intronic
1174552920 20:51374574-51374596 GGTAACATATTCACAGGTTCTGG + Intergenic
1175555034 20:59845708-59845730 GGAAACAAATACTCAGCTTTAGG - Intronic
1177101869 21:16907948-16907970 GGGAACAAATATACAGGTATTGG + Intergenic
1177494097 21:21866446-21866468 GGAAACATATATAAACCTTTTGG + Intergenic
1177588327 21:23128362-23128384 GGTAACATATTTATAGATTCTGG + Intergenic
1177710114 21:24762979-24763001 GGTAACATATTTACAGATTCTGG + Intergenic
1177710834 21:24772391-24772413 GGTAACATATTTACACTTTGGGG - Intergenic
1177881287 21:26698122-26698144 GGATACATATATACATCTGTAGG + Intergenic
1178020654 21:28404581-28404603 GGTAACATATTTACAAGTATAGG + Intergenic
1179169500 21:38962021-38962043 GGTGACACATTTGCAGCTTTTGG + Intergenic
1181293399 22:21815640-21815662 GGAAACTTTTATCCAGCTTTGGG + Intronic
1181990442 22:26832880-26832902 GATAACATATTCACAGGTTTTGG + Intergenic
1182924619 22:34110600-34110622 GGTAGCATATTTACAGGTTCTGG + Intergenic
950832096 3:15885144-15885166 GGTAACATATTTATAGGTTCTGG - Intergenic
953148581 3:40303162-40303184 GGTAATATATATAAATCTTGTGG + Intergenic
953370788 3:42386535-42386557 GGTCACATATTTCCAGGTTTGGG + Intergenic
953900911 3:46843366-46843388 AGTAACATATTCACAGATTTTGG - Intergenic
955142139 3:56279935-56279957 AGTAACATATACACAGGATTTGG - Intronic
955695302 3:61629849-61629871 TGTAACATGTCTTCAGCTTTAGG + Intronic
955896594 3:63707099-63707121 GGTAACATATTCCCAGGTTTTGG + Intergenic
956408570 3:68954363-68954385 GGGAATATATATACAGCCTAAGG + Intergenic
956792669 3:72692321-72692343 GGAAACATATGTTCAGCTTTAGG + Intergenic
956928352 3:74014310-74014332 AGTAACATATTTCCAGTTTTGGG - Intergenic
958168791 3:89912844-89912866 TTTAACATTTATCCAGCTTTCGG - Intergenic
958516159 3:95118706-95118728 TGTTAGATATATACAGCTTTTGG + Intergenic
958639985 3:96794107-96794129 AGTAACATAGATACATCTTCAGG - Intergenic
958643606 3:96840277-96840299 GGCAAAATATATACACCTCTTGG + Intronic
959167067 3:102793765-102793787 GGTAACATATTTACAGGTTCTGG - Intergenic
959499573 3:107090024-107090046 TATTACATATACACAGCTTTTGG + Intergenic
960027103 3:113021813-113021835 GGTAACATATTTACAGATTATGG + Intergenic
960085884 3:113590922-113590944 GGTAACATATTCACAGGTTCTGG - Intronic
960410887 3:117323043-117323065 AGTAACATGTAGATAGCTTTGGG - Intergenic
961143612 3:124575905-124575927 GGTAACATATTTATAGGTTCTGG + Intronic
962908963 3:139830376-139830398 GCTAATATATATACATCTGTTGG - Intergenic
966246451 3:177813295-177813317 GGTAACATATTCACAGGTTCTGG - Intergenic
966427012 3:179790467-179790489 AGTAACATATTCACAGATTTTGG + Intergenic
966435951 3:179884197-179884219 GGTAACATATTTACAGGTTCTGG - Intronic
966562619 3:181340582-181340604 AGTAACAAATTTACAGGTTTTGG - Intergenic
969521625 4:7681211-7681233 GGTAACATACATGCAGGTTCTGG - Intronic
969938931 4:10710945-10710967 GGAAACATGCTTACAGCTTTGGG - Intergenic
970734294 4:19148153-19148175 GGTAACATATTCACAGGTTTTGG + Intergenic
970870302 4:20809346-20809368 GGTAGAATATGTAGAGCTTTTGG + Intronic
971813662 4:31460621-31460643 GGTAACATATTCACAGGTTTGGG - Intergenic
972353929 4:38262869-38262891 TGTATAATATATTCAGCTTTAGG + Intergenic
972725092 4:41740393-41740415 GGCAACATATTTACAGCTCCCGG - Intergenic
973149292 4:46867149-46867171 GGAAACAGATATACTGCCTTTGG + Intronic
973165901 4:47077186-47077208 GGTAACATATACTGAGTTTTGGG - Intronic
974618908 4:64330097-64330119 GGTAGCATATAAACATATTTTGG - Intronic
976348011 4:84027486-84027508 GGTAACGTATTCACAGGTTTTGG + Intergenic
976798418 4:88959785-88959807 AGTAACATATTTACAGGTTCTGG + Intronic
976962595 4:90997487-90997509 AGTAACATATTTACAGCTTCTGG + Intronic
977790723 4:101098908-101098930 AGTAAGATAGAAACAGCTTTAGG - Intronic
978187315 4:105871879-105871901 GGAAGCATATAAACAGCTTTGGG - Intronic
978941134 4:114437101-114437123 GGTAACATATTCACAGATTCTGG - Intergenic
979070646 4:116200761-116200783 CATAACATATATAAAGCATTTGG - Intergenic
979080010 4:116325894-116325916 TGTAATATATAAACAGCTTGTGG - Intergenic
980299474 4:130969082-130969104 GATAAAATATAAACAGTTTTGGG + Intergenic
980950457 4:139370932-139370954 GGGAAAATATTTACAGCCTTAGG - Intronic
981701324 4:147610189-147610211 GGTAACATATGCACAGTTTCTGG - Intergenic
982150898 4:152455951-152455973 GGTAACATATATACAGCTTTTGG + Intronic
983570299 4:169200294-169200316 CTTAACATATAAACAGGTTTTGG - Intronic
983610974 4:169644709-169644731 GGTAACATATTTACAGGTTTTGG - Intronic
987246698 5:16056261-16056283 GGTAAAATATTTACAGGTTTGGG - Intergenic
987776575 5:22373760-22373782 AACAACATATATACATCTTTAGG + Intronic
987962726 5:24831379-24831401 GGTAACATATTCACAGATTCTGG - Intergenic
988054620 5:26078043-26078065 GGTAACAAATATACAGGTTATGG - Intergenic
988704757 5:33714148-33714170 TGTAACATATAGGCAGCTGTAGG - Intronic
990516507 5:56535535-56535557 GGTAACATAGTTACAGGTTCTGG + Intronic
991064304 5:62409629-62409651 AGTAACATATTCACAGGTTTTGG + Intronic
991345698 5:65664870-65664892 GGTCTCAGATACACAGCTTTTGG - Intronic
992510463 5:77428204-77428226 GGTAAAATAAAAACAGCTGTTGG - Exonic
992579762 5:78159706-78159728 GGTAACATATTCACAGGTTCTGG + Intronic
992617278 5:78556934-78556956 GGTCACACATAAACAGCTTCTGG + Intronic
993050176 5:82917373-82917395 GTTAATATATATAAAGCTCTTGG + Intergenic
993698363 5:91089260-91089282 AGTAATATACATACAGCTGTTGG + Intronic
994227171 5:97265958-97265980 AGTAACATATTCACAGCTTTTGG + Intergenic
994521167 5:100837832-100837854 GGTATCAAATATACATCTTTCGG - Intronic
994560062 5:101357493-101357515 GGTAAAATAAATACAGTATTTGG - Intergenic
994739046 5:103595319-103595341 GGTAACATATTCACAGATTTGGG + Intergenic
994774110 5:104022461-104022483 GGTAACATATTCACAGGTTCTGG + Intergenic
995856723 5:116600598-116600620 GGTAACATATTCACAAGTTTCGG + Intergenic
996624825 5:125557844-125557866 GATAACATATTCACAGGTTTGGG + Intergenic
996819041 5:127605362-127605384 GGTAACATATTCACAGGTTCTGG + Intergenic
996924979 5:128814196-128814218 GGTAGCATAAATACATCCTTGGG - Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
998939658 5:147267559-147267581 AGTAGCATATATACATCTATAGG - Intronic
999013355 5:148068410-148068432 GGTGACATAGATACAGCATTAGG - Intronic
999446032 5:151640086-151640108 GGTAACATATTCACAGGTTGGGG + Intergenic
999718634 5:154381985-154382007 GGTAACATATTCACAGGTTCCGG + Intronic
1001088437 5:168719009-168719031 GGTAACATATTTACAACTGAGGG - Intronic
1001307720 5:170587816-170587838 GGTAACATATTCACAGCTTCTGG + Intronic
1002509166 5:179701660-179701682 GTTAAAACCTATACAGCTTTTGG + Intronic
1003492939 6:6639772-6639794 GGTAACATATTCACAGTTTCTGG + Intronic
1004669172 6:17779570-17779592 GGTAAAATATATGCTACTTTAGG - Exonic
1004985435 6:21077391-21077413 GGTAACATATTCACAAGTTTCGG - Intronic
1005186712 6:23170832-23170854 GATAAAACATATCCAGCTTTTGG + Intergenic
1005270237 6:24156006-24156028 GGTAACATAGATTCAGGTCTAGG - Intergenic
1005446755 6:25931899-25931921 GGTAATATATTTACAGGTTCTGG + Intergenic
1005479693 6:26243663-26243685 GGAAACATATTCGCAGCTTTTGG - Intergenic
1005902601 6:30230526-30230548 GGTAACATATTCACAGATTCTGG - Intergenic
1006757613 6:36430338-36430360 GGTAACATATTCACAGGTTCTGG - Intronic
1007268599 6:40618187-40618209 GTAAACATATATAAAGCATTTGG + Intergenic
1007723864 6:43902498-43902520 TGTAACATAGACACAGCTTATGG + Intergenic
1008334969 6:50292132-50292154 GGGAAGACATATAAAGCTTTTGG + Intergenic
1008348538 6:50459776-50459798 GGTAACATATTCACAGATTCTGG + Intergenic
1008986422 6:57549186-57549208 GGTAAAATTTATTCAGGTTTAGG + Intronic
1009771810 6:68153160-68153182 GGTAACATATTCACAGGTCTGGG + Intergenic
1011110900 6:83835773-83835795 GATAACATATTTACAGGTTCTGG + Intergenic
1011476694 6:87755566-87755588 GGTAACATGTTCACAGGTTTTGG + Intergenic
1012708570 6:102567336-102567358 GAAAACATATATATAGCATTTGG - Intergenic
1013776744 6:113687321-113687343 GGTAACATATTCACAGGTTTTGG + Intergenic
1014617269 6:123618535-123618557 GGTAACATATTTACAGATTCTGG + Intronic
1014649109 6:124013635-124013657 GGTAACATATGCACAGATTTTGG - Intronic
1014857503 6:126419950-126419972 GGTAACATATTCACAGGTCTGGG + Intergenic
1015081597 6:129232687-129232709 GGGAACATATTTACAGGTTCTGG - Intronic
1015561914 6:134525209-134525231 GGTCAAATATAGACAGATTTTGG + Intergenic
1015820735 6:137257752-137257774 GGTAACATATATACAGAGTCTGG + Intergenic
1016879939 6:148901098-148901120 GGTAACATATTCACAGAATTTGG + Intronic
1020550723 7:9601026-9601048 AGTAACATATATACAGCTGGAGG + Intergenic
1020841869 7:13227972-13227994 AAAAACATATATAAAGCTTTTGG - Intergenic
1021086309 7:16424170-16424192 GGTAACATATTCATAGCTTCTGG - Intergenic
1021876910 7:25058178-25058200 GGTAACATATTCACAGGTTCTGG + Intergenic
1023546683 7:41325117-41325139 GGTAACATATTCACAGGTTCCGG + Intergenic
1027134100 7:75612025-75612047 GGTCACATACACACAGCTCTTGG + Intronic
1027627251 7:80561814-80561836 GGGAACATATATATATATTTAGG + Intronic
1029031715 7:97475180-97475202 GGTAACATATTCAGAGCTTCTGG - Intergenic
1029252475 7:99246805-99246827 GGTAACATATATACTGCAGAAGG - Intergenic
1029906796 7:104100853-104100875 GGCAACATATTCACAGGTTTAGG - Intergenic
1030168124 7:106574804-106574826 GGTAACATATTCACAGATTCTGG - Intergenic
1031418009 7:121516520-121516542 GTTAACATATATGCAAATTTAGG + Intergenic
1031544822 7:123037909-123037931 GGTAACATATTTACCGCTCTTGG + Intergenic
1031776834 7:125916036-125916058 AGTGAAATATATACAGCTCTAGG - Intergenic
1032330067 7:130970318-130970340 TCTAAGAAATATACAGCTTTTGG + Intergenic
1033025244 7:137765877-137765899 AGGAACATAGATAAAGCTTTGGG - Intronic
1033814752 7:145058058-145058080 GGTAAAATATTCACAGGTTTTGG + Intergenic
1034206654 7:149322004-149322026 GGGGACTTATATACAGCATTTGG - Intergenic
1036537320 8:9662901-9662923 GGTAACATAGTTACAGGTTCTGG - Intronic
1037696479 8:21228451-21228473 GGTCACACATGTACTGCTTTTGG - Intergenic
1038966633 8:32580260-32580282 GGTAACATATTCACAGGTTCTGG + Intronic
1040634933 8:49262144-49262166 GTTAACATATATACATATATAGG + Intergenic
1043431210 8:80196740-80196762 AGTAACATATGTACAGGCTTTGG + Intronic
1043612726 8:82085166-82085188 GGTAACATATTGACAGTTTTCGG - Intergenic
1045340110 8:101246117-101246139 GGTAACATATGAACAGGTTCTGG - Intergenic
1046025807 8:108722235-108722257 AGTAATATATTTACAGGTTTGGG + Intronic
1046183448 8:110682924-110682946 GGTAACATATTTATAGGTTCTGG - Intergenic
1046765843 8:118068671-118068693 GGAAATATATATCCAGGTTTAGG - Intronic
1046895845 8:119472157-119472179 GGTAACATATTCACAGTTTGTGG - Intergenic
1046980760 8:120334010-120334032 GGTAACATATTCACAGGTTCTGG + Intronic
1047005657 8:120617396-120617418 GGTATCATACATAAAGCTCTAGG + Intronic
1047381213 8:124365552-124365574 TGTAACATATATACAGGTTAGGG - Intronic
1048454052 8:134561937-134561959 GGTAACATATTTACGGGTTCCGG - Intronic
1049998185 9:1050723-1050745 GTTAAAAGATATCCAGCTTTAGG - Exonic
1050127876 9:2378263-2378285 GGTAACATATTCACAGCTTCAGG - Intergenic
1050881303 9:10703314-10703336 AGTAACATACATACAGCTAGAGG - Intergenic
1051550258 9:18319798-18319820 GGTAACATATTCACAGATTCAGG - Intergenic
1052832569 9:33228273-33228295 GGTAACATATTCACAGGTTTGGG + Intronic
1055107832 9:72530768-72530790 GGTATCAAATTTTCAGCTTTAGG + Intronic
1055700680 9:78942600-78942622 GATCACATATATACAGATATAGG - Intergenic
1055817153 9:80220151-80220173 GGTAAAATATTCACAGGTTTGGG + Intergenic
1055889835 9:81111687-81111709 GGTAACATATTCACAGGTTTGGG + Intergenic
1056741331 9:89257865-89257887 GGTAACATATTTACAGCTTCTGG - Intergenic
1058737736 9:107909323-107909345 TGTAACATATTCACAGATTTTGG + Intergenic
1058847190 9:108972588-108972610 GTTAACACAAATACAGTTTTGGG - Intronic
1059030316 9:110686362-110686384 GGTAACATATTGACAGATTTTGG + Intronic
1060118774 9:120968107-120968129 GGTAACATATTCACAGGTTCAGG - Intronic
1061657277 9:132102142-132102164 GGTAACATATTCACAGGTTCTGG + Intergenic
1186125887 X:6413407-6413429 GGTCACATATTTACAGGTTCTGG - Intergenic
1186698862 X:12067894-12067916 GGTAACATATTTACTGGTTCTGG - Intergenic
1187847153 X:23551867-23551889 TGTTATATATATGCAGCTTTGGG + Intergenic
1187971035 X:24658773-24658795 GGTAACATATTCACAGGTTCTGG + Intronic
1188125450 X:26362641-26362663 GGTAAAATATACAAAGCTTTGGG + Intergenic
1188266897 X:28087967-28087989 AGTAACATATTTACAGGTTCAGG + Intergenic
1188358982 X:29229000-29229022 GGTTACATATATTCAACTCTGGG + Intronic
1189085818 X:38022714-38022736 GGTAACATATTCACAGGTTCTGG + Intronic
1191941702 X:66488298-66488320 TGTACCATATATCCAGTTTTGGG - Intergenic
1192381710 X:70623833-70623855 GGTAAGATCAATACAGGTTTTGG - Intronic
1193325587 X:80175844-80175866 GGCCACTTGTATACAGCTTTAGG - Intergenic
1194079808 X:89446582-89446604 GGTGACATATTCACAGGTTTTGG - Intergenic
1198279573 X:135128331-135128353 GGTAACATATTCACAGGTTATGG + Intergenic
1198291384 X:135244183-135244205 GGTAACATATTCACAGGTTATGG - Intergenic
1199675706 X:150187511-150187533 GGTAACATATTCACAGCTTCTGG + Intergenic
1200432427 Y:3101871-3101893 GGTGACATATTCACAGGTTTTGG - Intergenic
1201078180 Y:10202627-10202649 GGTAACAGATTTAAATCTTTAGG + Intergenic