ID: 982151168

View in Genome Browser
Species Human (GRCh38)
Location 4:152459070-152459092
Sequence ATGGCCCCCTAGGAGAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982151165_982151168 -8 Left 982151165 4:152459055-152459077 CCAAGATGCAGTGAAATGGCCCC 0: 1
1: 0
2: 1
3: 24
4: 511
Right 982151168 4:152459070-152459092 ATGGCCCCCTAGGAGAGGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 165
982151163_982151168 10 Left 982151163 4:152459037-152459059 CCTCTCTGTATATTCACTCCAAG 0: 1
1: 0
2: 0
3: 10
4: 126
Right 982151168 4:152459070-152459092 ATGGCCCCCTAGGAGAGGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982151168 Original CRISPR ATGGCCCCCTAGGAGAGGTG AGG Intronic
900496560 1:2978553-2978575 CTGGGCCCCAAGGGGAGGTGAGG + Intergenic
900607814 1:3531529-3531551 GCGGCCCCCTGGGGGAGGTGGGG - Intronic
900950734 1:5857043-5857065 AGGACCCCCTCGGAGAGGTGAGG + Intergenic
901027485 1:6286280-6286302 GTGCCCACCTAGGAGAGGTGTGG + Intronic
901772563 1:11537722-11537744 AGGGCACCCTAGGGGAGGTGGGG + Intergenic
903674898 1:25057429-25057451 ATGGCGACCTAGGAAGGGTGAGG + Intergenic
904608023 1:31709314-31709336 ACGGCCCCGTAGGGGAGATGGGG - Intergenic
906153312 1:43600248-43600270 CTGGCCCCCTCAGAGAGGAGGGG - Intronic
907450602 1:54543243-54543265 AGGGGCCCCTAGGAGGGGTCAGG + Intronic
908007218 1:59739375-59739397 ATGGCCAGATAGGTGAGGTGAGG - Intronic
908254567 1:62292491-62292513 ATGGCTTCCTGGGGGAGGTGGGG - Intronic
908840963 1:68279743-68279765 ATGGGCCCTTAGGAGTGTTGGGG + Intergenic
910210061 1:84783353-84783375 AAGGTCCCCTGGGAGAGGTGGGG - Intergenic
917155341 1:171991682-171991704 ATGACCTCCTAGGAGGGATGAGG - Intronic
918097134 1:181344937-181344959 TTGGCCACCTAGGAATGGTGGGG - Intergenic
918692348 1:187497143-187497165 ATGGCCCCATGGGAGATGTTTGG - Intergenic
919978692 1:202629076-202629098 ATGGCTCCAGTGGAGAGGTGGGG + Intronic
921754893 1:218843607-218843629 ATGGCCCTGGAGGAGAGTTGGGG + Intergenic
922570040 1:226629239-226629261 GTGGTGCCCTAGCAGAGGTGGGG + Intergenic
923161410 1:231317671-231317693 CTGGGCTTCTAGGAGAGGTGGGG + Intergenic
1067146966 10:43701172-43701194 AGGGGCCCATAGGAGAGGAGGGG + Intergenic
1067167782 10:43879224-43879246 AGGGCCTCATAGGAAAGGTGTGG - Intergenic
1067697031 10:48542909-48542931 AAGGCTCCATAGGAGAGCTGGGG + Intronic
1072090813 10:92125485-92125507 CTGTCCCACTATGAGAGGTGAGG + Intronic
1073115312 10:101088438-101088460 ATGGCACTCTTTGAGAGGTGGGG + Intergenic
1073382466 10:103089977-103089999 ATGGCCACCTAACAGAGGAGAGG - Exonic
1074973751 10:118564729-118564751 ATGCCCCATTAGGAGAGTTGGGG - Intergenic
1075546560 10:123359397-123359419 AAAGCCCCCTAGGCCAGGTGCGG + Intergenic
1077230751 11:1457258-1457280 ATGGCACCCTAGGAGGGCCGCGG + Intronic
1077695482 11:4389146-4389168 ATGATTTCCTAGGAGAGGTGGGG - Intronic
1079688429 11:23391953-23391975 TTGGATCCCTAAGAGAGGTGAGG - Intergenic
1082278669 11:50247049-50247071 AAGGACCCCTGGGAGAGGAGAGG + Intergenic
1084426140 11:69085459-69085481 AAGGGCTCCTAGGAGAGGTGCGG - Intronic
1087137379 11:94734648-94734670 ATGCTCCCCTGGGAGAGGAGGGG + Intronic
1090362294 11:126182105-126182127 CTGGCCCCCGAGGTGAGCTGCGG - Intergenic
1090711669 11:129391852-129391874 ATGGCCCCTGAGGAGAGGCTGGG + Intronic
1091277568 11:134362751-134362773 ATGGCCCCCGAGGAGGGGATGGG + Intronic
1096592195 12:52667747-52667769 GTGGGCCCCTGGGAGGGGTGGGG + Intergenic
1096984260 12:55745767-55745789 AGAGCAGCCTAGGAGAGGTGGGG - Intronic
1100361053 12:93879810-93879832 ATGTGCCACTGGGAGAGGTGGGG + Intronic
1101070336 12:101068170-101068192 ATAGCCCCATAGGAGTGGAGTGG + Intronic
1102417132 12:112773700-112773722 ATGGGCCACAATGAGAGGTGGGG + Intronic
1102535275 12:113576335-113576357 AAGGCCTCCTGGGGGAGGTGAGG + Intergenic
1104752015 12:131245859-131245881 ATGGCCTCCATGGAAAGGTGTGG - Intergenic
1106831878 13:33592999-33593021 GTGGGCACCTAGGAGAGGGGTGG + Intergenic
1107041187 13:35949442-35949464 ATGGCCGCCTAGGAGCAGAGTGG - Intronic
1108944059 13:55999571-55999593 ATGGCTCCCTGGGGGAGGTTTGG - Intergenic
1113037770 13:106070096-106070118 ATGGCCCTGGAGGAGATGTGGGG - Intergenic
1113424790 13:110199164-110199186 ATGTGCCCCTGGGAGAGCTGAGG + Intronic
1117332554 14:54727477-54727499 ATGGCCCCCAAGGCTGGGTGTGG - Intronic
1119617304 14:76107357-76107379 ATGGCGCCCTAGGATGGGGGAGG + Intergenic
1120940099 14:89939615-89939637 ACTGCCCCCTAGAGGAGGTGTGG - Intronic
1121447863 14:93989517-93989539 ATGGCTTCCTAGGAAGGGTGTGG - Intergenic
1122190135 14:100035863-100035885 GCTGCCCCCTAGGTGAGGTGGGG - Intronic
1122557003 14:102585863-102585885 TTGGCACCCTAGCAAAGGTGTGG + Intergenic
1122898643 14:104772872-104772894 AAGGACCCCAAGCAGAGGTGAGG - Exonic
1202892990 14_KI270722v1_random:177054-177076 ATGCCTCTCTAGGAGACGTGAGG + Intergenic
1124494299 15:30177002-30177024 ATGGCTCCAGTGGAGAGGTGGGG + Intergenic
1124749271 15:32361643-32361665 ATGGCTCCAGTGGAGAGGTGGGG - Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1129333854 15:74841002-74841024 GTGGCCACATAGGAGGGGTGTGG - Intronic
1129778012 15:78249620-78249642 AGGCCCCCCTTGGTGAGGTGAGG - Intergenic
1130104050 15:80915725-80915747 AAGGCAGCCCAGGAGAGGTGGGG - Intronic
1131597586 15:93813649-93813671 TTGTCCAGCTAGGAGAGGTGGGG - Intergenic
1136093083 16:27934647-27934669 ATGGCACCATGGGAGAGCTGTGG + Intronic
1136922353 16:34343688-34343710 ATGCCCCCCCAGGTGAAGTGAGG - Intergenic
1136982220 16:35068118-35068140 ATGCCCCCCCAGGTGAAGTGAGG + Intergenic
1138338004 16:56268013-56268035 ATGCTCCCCTGGGAGAGGGGAGG - Intronic
1138576734 16:57912180-57912202 ATGTCGCCCCAGGAGAGATGTGG + Intronic
1142760877 17:2041466-2041488 ACGGCCGCCTAGGGGAGGGGAGG - Exonic
1143592655 17:7894905-7894927 TTGGCCCCCTAGGAGAAGGAGGG + Exonic
1146492238 17:33291664-33291686 AGGTCCCCCTTGGAGAGGCGCGG + Exonic
1147725534 17:42564254-42564276 ATGGCCCCAGAGGAGAGAAGTGG + Intronic
1147741514 17:42673286-42673308 CTGGCCCCCTAGGAAAGTTGCGG - Exonic
1148494070 17:48041965-48041987 CTGGCTCCATAGGGGAGGTGGGG + Intergenic
1149095647 17:52837475-52837497 AAGTCCCCCTAGGAGAAGAGAGG + Intergenic
1151670741 17:75570482-75570504 CTGGCCCCCCAGGAGAGGTGAGG + Exonic
1152558491 17:81066477-81066499 ATGCCCACCTGGGAGAGCTGGGG + Intronic
1159020175 18:63136791-63136813 ATGGCCAGCTAGGAGTGCTGGGG - Intronic
1159028215 18:63206133-63206155 ACATCCCCCTGGGAGAGGTGTGG - Intronic
1160752024 19:738852-738874 ATGGCCCCTCAGAAGTGGTGAGG + Intronic
1162481048 19:10927413-10927435 AAGGCCTCCTGGGGGAGGTGAGG - Intronic
1163653640 19:18532953-18532975 TTGGCTCCCTAGGAGGGATGGGG - Intronic
1164888654 19:31804603-31804625 TTGGCTCCCTGGGTGAGGTGAGG - Intergenic
1166047064 19:40235884-40235906 AAGGACCCCAAGCAGAGGTGAGG - Exonic
1167971877 19:53192877-53192899 ACGGCGCCTTAGGAGAGGGGTGG + Intronic
925293884 2:2765476-2765498 AGTGTCCCCTAGGAGAGGAGCGG - Intergenic
926130450 2:10300693-10300715 CTGGCCCCTTTGGAGAGATGTGG - Intergenic
926329916 2:11815821-11815843 ATGGCCCCATAGGTGAAGGGAGG - Intronic
927418186 2:22901841-22901863 ATGGCCCCATAGCTGAGCTGTGG - Intergenic
932409284 2:71535585-71535607 ATGGCCCGGCAGGAGGGGTGGGG + Intronic
932707786 2:74039981-74040003 ATTTCCCCCATGGAGAGGTGGGG - Intronic
938856403 2:135316419-135316441 ATGGACCCCTAGGAGATGATTGG - Intronic
939795613 2:146640974-146640996 AGGGCCCCATAGGAGATGTTTGG - Intergenic
940878581 2:158922911-158922933 AAGGCACCCTAGTAGAGGTGAGG + Intergenic
941886502 2:170533280-170533302 ATGGGGCCCAAGGACAGGTGAGG - Intronic
942451055 2:176108092-176108114 AGGGCCCCCCGGGAGAGGCGGGG + Exonic
942452781 2:176118471-176118493 CTGACTGCCTAGGAGAGGTGGGG + Intronic
946904894 2:224406568-224406590 TTGTCCCCTTAGGAGTGGTGAGG - Intergenic
1168939221 20:1694895-1694917 AGGGGCCCATAGGGGAGGTGGGG - Intergenic
1170511966 20:17086568-17086590 GTGGCCCCCTGGTTGAGGTGTGG + Intergenic
1172571143 20:35971704-35971726 AAGGCACCCTAGGCCAGGTGCGG - Intronic
1174545822 20:51324431-51324453 ATGGTCCTCTAGGAGAGCCGAGG + Intergenic
1175592184 20:60201996-60202018 ATGGGCTCCTTGGAGAGATGAGG + Intergenic
1176002578 20:62839673-62839695 AGGGCACCCAGGGAGAGGTGGGG - Intronic
1176002596 20:62839721-62839743 AGGGCACCCAGGGAGAGGTGGGG - Intronic
1176002614 20:62839769-62839791 AGGGCACCCAGGGAGAGGTGGGG - Intronic
1179436763 21:41367782-41367804 GTGGACCCAGAGGAGAGGTGAGG - Intronic
1180801653 22:18634696-18634718 AGGGCAGCCTAGGCGAGGTGCGG + Intergenic
1180852897 22:19030235-19030257 AGGGCAGCCTAGGCGAGGTGCGG + Intergenic
1181220070 22:21360565-21360587 AGGGCAGCCTAGGCGAGGTGCGG - Intergenic
1182032157 22:27167900-27167922 CTGGCACCCTGGGAGATGTGTGG + Intergenic
1183355289 22:37355537-37355559 ATGGCCCCGCTGCAGAGGTGAGG - Intergenic
1184778751 22:46635760-46635782 ACGGCCACCTAGGACAGGAGTGG - Intronic
1185077380 22:48690625-48690647 AGGGCTCCCTAGAAGAGATGAGG - Intronic
949388069 3:3527186-3527208 ATGGTCCCAATGGAGAGGTGTGG - Intergenic
952171898 3:30816234-30816256 AAGGCCCCCTGGAAGAGTTGAGG + Intronic
956104829 3:65806849-65806871 ATGTCCCCCTTGAAGAGGGGAGG + Intronic
959667373 3:108936889-108936911 ATGGCACTGAAGGAGAGGTGTGG - Intronic
967180091 3:186896010-186896032 AGGAGCCCCTAGTAGAGGTGGGG - Intergenic
968297787 3:197590917-197590939 ATGCCCCCTTCAGAGAGGTGAGG - Intergenic
968920833 4:3521459-3521481 ATGGACCTTTGGGAGAGGTGCGG - Intronic
968936364 4:3612506-3612528 CTGCCCACCTGGGAGAGGTGTGG + Intergenic
971424294 4:26501173-26501195 AATTCCCCCTGGGAGAGGTGAGG - Intergenic
974885109 4:67809111-67809133 ATGGCCCACTAGAAGTAGTGGGG + Intergenic
977440253 4:97056953-97056975 ATGGCCTCCCAAGTGAGGTGGGG + Intergenic
980027231 4:127781821-127781843 ATGGGCCCCTCGGGGAGGCGAGG + Intronic
982074421 4:151724393-151724415 AGGTCACCTTAGGAGAGGTGTGG - Intronic
982151168 4:152459070-152459092 ATGGCCCCCTAGGAGAGGTGAGG + Intronic
991212339 5:64120252-64120274 ATGGCTGCATAGGAGGGGTGAGG - Intergenic
991429354 5:66528209-66528231 ATGGTCCTCTGGGAGAGATGGGG + Intergenic
996714111 5:126572758-126572780 AGAGCCCCATTGGAGAGGTGTGG - Intronic
997622494 5:135307863-135307885 CTGGCCCCCCAGGAGAGAGGAGG - Intronic
999833925 5:155349008-155349030 TTGGGCCTCTAAGAGAGGTGAGG + Intergenic
1001296979 5:170505025-170505047 ATAGCCGCCTAGGAGGAGTGTGG - Intronic
1001421767 5:171593003-171593025 CAGGCCCCCTGTGAGAGGTGAGG - Intergenic
1002845336 6:940040-940062 CTGCCACCCTAGGAGAGGTTTGG + Intergenic
1005491535 6:26352073-26352095 ATGTCCCCCAAGGATAAGTGGGG + Intergenic
1005605015 6:27467880-27467902 ATGTCCCCCTTGGAGAAGGGTGG + Exonic
1007393754 6:41565552-41565574 ATGTCCCCCCAGGTGAGGGGTGG - Intronic
1015903870 6:138096090-138096112 AGGGCCCCCTAAGAGAGATAGGG + Intronic
1016908969 6:149178317-149178339 ATGGTCCCCTAGTAGAGTGGGGG + Intergenic
1018166811 6:161105564-161105586 ATGGCTTCCTAGAAGAGGCGTGG + Intronic
1018442590 6:163826552-163826574 ATGAACCTCTAGGGGAGGTGAGG - Intergenic
1018910529 6:168098725-168098747 GAGGGACCCTAGGAGAGGTGAGG + Intergenic
1018983501 6:168617870-168617892 ATGGCCTACTTGGAGAGGCGGGG + Intronic
1019576361 7:1739563-1739585 AAGACCCCCTGGGAGAGCTGGGG + Intronic
1020103997 7:5412729-5412751 ATGGCCTCCAAGCTGAGGTGTGG - Intronic
1021899398 7:25268571-25268593 ATAGACCTCTAGGAGAGGGGAGG + Intergenic
1022391605 7:29949023-29949045 GTGGCACCCTAGGACAGGAGCGG + Intronic
1022846740 7:34217453-34217475 ATGACCCTAAAGGAGAGGTGAGG - Intergenic
1022918420 7:34985420-34985442 TTGGCCCCTTATCAGAGGTGTGG - Intronic
1024940397 7:54757963-54757985 ATGGTTCCTTAGGAGCGGTGAGG - Intronic
1025715703 7:63953495-63953517 ATGTCTCCCCAGGAGAGCTGGGG + Intergenic
1030711591 7:112756539-112756561 ATGGCCCACTATGATAGATGAGG - Intergenic
1033229961 7:139588895-139588917 CTGGCTCCCGAGGGGAGGTGAGG + Intronic
1034557760 7:151860768-151860790 AGTGCCCTCTAGGAGAGGTAGGG - Intronic
1036111739 8:5910528-5910550 ATTGTCCAATAGGAGAGGTGTGG - Intergenic
1036220898 8:6921035-6921057 ATGGCCCCCGAGGTGGGCTGTGG - Intergenic
1039388591 8:37158770-37158792 ATGGCCTCCCAGGGGAGGTAAGG - Intergenic
1040939191 8:52815416-52815438 ATGGCATCCCAGGAGATGTGCGG - Intergenic
1049780705 8:144427547-144427569 ATGGCCCACGAGGAGAGTTTGGG + Intronic
1056378636 9:86037662-86037684 TTGGATCCATAGGAGAGGTGAGG + Intronic
1056754494 9:89373319-89373341 TTGGCCATCCAGGAGAGGTGAGG - Intronic
1058625614 9:106929981-106930003 ATGGCTCCCCAGGGGAGGTTTGG + Intronic
1059639762 9:116205096-116205118 GGGTTCCCCTAGGAGAGGTGGGG + Intronic
1060942679 9:127552071-127552093 ATGGCACGCCAGCAGAGGTGGGG - Intronic
1061882100 9:133573726-133573748 ATGGCCGCCTGGGAAGGGTGGGG + Intronic
1062145130 9:134984854-134984876 ATGGCTCCCCAGGAAGGGTGTGG + Intergenic
1185919831 X:4078830-4078852 TGGGCTCCCTAGGGGAGGTGTGG - Intergenic
1186191224 X:7069248-7069270 ATGCCCCCCGAGGCGAGGTGAGG + Intronic
1187527958 X:20071097-20071119 ATGGCTCCCCAGAGGAGGTGAGG - Intronic
1189587751 X:42478014-42478036 ATCGCCCCTTAGGAGAGCAGGGG - Intergenic
1195567904 X:106363626-106363648 TTGGGCCCCTAGGAGAGGCCAGG + Intergenic
1197735916 X:129850548-129850570 ACGGCCCCATATGAGAAGTGAGG + Intergenic