ID: 982155277

View in Genome Browser
Species Human (GRCh38)
Location 4:152514193-152514215
Sequence CTGTCTCAGAAGAAGCTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982155276_982155277 -10 Left 982155276 4:152514180-152514202 CCATTGGACAATGCTGTCTCAGA 0: 1
1: 0
2: 2
3: 43
4: 168
Right 982155277 4:152514193-152514215 CTGTCTCAGAAGAAGCTAAGTGG 0: 1
1: 0
2: 1
3: 16
4: 260
982155274_982155277 25 Left 982155274 4:152514145-152514167 CCAGAAAATTTAAATTTAACTAT 0: 1
1: 1
2: 3
3: 111
4: 784
Right 982155277 4:152514193-152514215 CTGTCTCAGAAGAAGCTAAGTGG 0: 1
1: 0
2: 1
3: 16
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982155277 Original CRISPR CTGTCTCAGAAGAAGCTAAG TGG Intronic
900378553 1:2372578-2372600 CTCTCCCAGAACAAGCTACGAGG - Exonic
901232638 1:7649740-7649762 CTGTCACGGAAGCAGCTATGCGG - Intronic
902136267 1:14308710-14308732 AGGTCTCAGAAAATGCTAAGAGG - Intergenic
902615721 1:17622606-17622628 CTGTCTCTGACAAAGCTAATTGG + Intronic
902829175 1:18998735-18998757 CTGTCTCAGTGGACTCTAAGGGG - Intergenic
903313123 1:22476228-22476250 CTGTCTCAAAAGAAACTTTGAGG - Intronic
904866167 1:33580636-33580658 CTGCCTCACCTGAAGCTAAGTGG - Intronic
908221287 1:62009186-62009208 CTGGGTCAGAAAAAGCTAAAAGG + Intronic
909430831 1:75585850-75585872 CTGAGTCAGAAGAAGCTCTGAGG - Intronic
911023461 1:93412069-93412091 CTGTCTCAAAAAAAAATAAGGGG - Intergenic
911064371 1:93774571-93774593 CTGTCTCAGTACAGGCTATGTGG - Intronic
911601444 1:99852373-99852395 CTGTCTCAGAAAAAGAGAAAAGG - Intronic
912924708 1:113904007-113904029 CTGTCTCAAATGAGGCAAAGTGG + Intronic
913014549 1:114719294-114719316 CTGTCTCTGGGGAAGCAAAGCGG + Intronic
913052975 1:115133142-115133164 ATGTATCAAATGAAGCTAAGTGG - Intergenic
913657718 1:120977119-120977141 CTGTGTGAGAACAATCTAAGAGG - Intergenic
914009069 1:143760203-143760225 CTGTGTGAGAACAATCTAAGAGG - Intergenic
914522284 1:148428389-148428411 CTGTGTGAGAACAATCTAAGAGG - Intergenic
914647698 1:149668855-149668877 CTGTGTGAGAACAATCTAAGAGG - Intergenic
915499680 1:156306813-156306835 CTGTCTCAGAAAAAAAAAAGAGG + Intergenic
916539820 1:165742265-165742287 CTGTCTCAAAAAAAGAAAAGGGG - Intronic
917241806 1:172956727-172956749 CTGCCTCAGGAGAGGCAAAGGGG - Intergenic
918482330 1:184991990-184992012 CTGTCTCAGAAAAAGTTACCAGG - Intergenic
919144927 1:193621823-193621845 CTGTCTCAAAAGAGGGAAAGTGG - Intergenic
922631083 1:227111968-227111990 ATGACTCAGGAGAAGCTCAGGGG - Intronic
1063011589 10:2027069-2027091 CTTCCTCCTAAGAAGCTAAGAGG + Intergenic
1064134526 10:12739230-12739252 CTGTCTCAGAAAAAGAAAAAAGG + Intronic
1064761422 10:18625403-18625425 GTGTCTCATCAAAAGCTAAGAGG + Intronic
1064762473 10:18635527-18635549 GTGTCTCATCAAAAGCTAAGAGG + Intronic
1064971058 10:21067649-21067671 CTCTCTCAGATTAAGCTGAGAGG - Intronic
1064971679 10:21072984-21073006 CTGTCTCAGAAAAAGAAAAAGGG + Intronic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1068847800 10:61699618-61699640 GTCTCTCAGACGAAGCTATGAGG - Intronic
1073361612 10:102903901-102903923 CTGTCTCAGAAAAAAAAAAGGGG + Intergenic
1075338966 10:121630259-121630281 CTGTCTCGGAAGAAGGAAGGAGG + Intergenic
1076601691 10:131660834-131660856 ATGTGGAAGAAGAAGCTAAGGGG + Intergenic
1078002871 11:7512193-7512215 CTGGCTCACAAGAAGCAAAGTGG - Intergenic
1079016064 11:16869976-16869998 CTGTCTCAGATGAATGGAAGGGG + Intronic
1079574655 11:21988584-21988606 CTTTCTGAGAAGAAGCTTTGAGG - Intergenic
1082617133 11:55374562-55374584 CTTCCTCAGAAGAAGCAACGTGG - Intergenic
1082619644 11:55404287-55404309 CTCCCTCAGAAGAAGCAATGTGG - Intergenic
1082625538 11:55479916-55479938 CTTCCTCAGAAGAAGCAACGTGG - Intergenic
1083348886 11:62013252-62013274 GTTTCTGAGAAGAAGCTCAGAGG - Intergenic
1087805743 11:102553253-102553275 CTGTCTCAGGAGAGGCTTAATGG + Intergenic
1088190760 11:107226005-107226027 CTGTCTCAAAAAAAGAAAAGAGG - Intergenic
1088301900 11:108366990-108367012 CTGTCTCAGAAAAAAATGAGGGG - Exonic
1089356844 11:117859414-117859436 ATGCCACAGAAGAAACTAAGAGG + Intronic
1090266940 11:125359269-125359291 CAGTCACAGAAAAAGCTTAGGGG - Intronic
1090341834 11:126029799-126029821 TTGTCTGAGAAGATGCTTAGTGG + Intronic
1092649595 12:10619530-10619552 CTGTCTCAGAATCAGATAAAAGG + Exonic
1094247119 12:28311335-28311357 CTGTGTCAGAGGAAGCTGAGTGG - Intronic
1095047369 12:37522415-37522437 CTCTTTTAGTAGAAGCTAAGAGG - Intergenic
1096552583 12:52382997-52383019 GTGGCTCTGAAGAAGGTAAGGGG - Exonic
1097164990 12:57079411-57079433 TTGTCTCACAAGATGATAAGAGG - Intronic
1097240558 12:57572253-57572275 CTGTCTCAGAAGGTGGTAAGTGG + Exonic
1097245007 12:57603044-57603066 CTGTCTCACAAGAAGCCATGAGG + Exonic
1099412889 12:82353095-82353117 ATGTCACAGAAGAACCTAATAGG + Exonic
1101660035 12:106757615-106757637 CTTCTCCAGAAGAAGCTAAGAGG + Intronic
1102847034 12:116196072-116196094 CAGTTTCAGAACAAGCAAAGAGG + Intronic
1104395667 12:128430200-128430222 CTGTGTCATACGAAGCGAAGTGG - Intronic
1104806554 12:131592802-131592824 CTGCCTGACAAGAAGCTCAGAGG - Intergenic
1107070494 13:36262976-36262998 CTGTCCTAGAAGAAGCCAAAGGG + Intronic
1107112492 13:36712866-36712888 CTGCCTCACAAGAAGCTGAAAGG - Intergenic
1107605579 13:42052363-42052385 CTTTCTCTGAATAACCTAAGTGG + Intronic
1108710464 13:53028021-53028043 CTGGCTCACAAGAAGCTCAGGGG + Intergenic
1109739451 13:66532975-66532997 CTATCTCTGAAGAAGTTAAAAGG + Intronic
1110550041 13:76801755-76801777 CTGTCTCAGAAGAAAAAAAATGG + Intergenic
1111705209 13:91740075-91740097 GTGTGGCGGAAGAAGCTAAGTGG - Intronic
1114074243 14:19146331-19146353 CTGTCACAGAAGGAGCAAGGGGG + Intergenic
1114088025 14:19253644-19253666 CTGTCACAGAAGGAGCAAGGGGG - Intergenic
1115976726 14:39005000-39005022 ATGACTCTGGAGAAGCTAAGTGG - Intergenic
1116915835 14:50524984-50525006 GTGTCTGAGAAGAAACAAAGCGG - Intronic
1117999309 14:61508309-61508331 CTGTTTCAGAAGTATCAAAGGGG + Intronic
1120997968 14:90430983-90431005 CTCTCCCAAGAGAAGCTAAGGGG - Intergenic
1121769895 14:96524526-96524548 CTGTCTCAAAAAAAGAGAAGGGG - Intronic
1122297817 14:100714986-100715008 CTTTCTCAGAAGGAGCCAGGGGG + Intergenic
1122322411 14:100863093-100863115 CAGTGTCTGAAGAAGCTCAGAGG + Intergenic
1122670477 14:103367892-103367914 CTGTCTCAGAAAAAAAGAAGGGG + Intergenic
1124091883 15:26613110-26613132 CTGTCTCAAAAGAAACAAACAGG + Intronic
1124237354 15:28002277-28002299 CTGGAACAGAGGAAGCTAAGAGG + Intronic
1126943371 15:53790526-53790548 TTGTCTCAGAAAAAACTAAACGG - Intergenic
1127572743 15:60260274-60260296 CTATCTCAGAAGAGGTGAAGAGG - Intergenic
1128156301 15:65394003-65394025 CTGTCTCAGAAAAAAATAAAAGG - Intronic
1128561354 15:68670050-68670072 CTGTCTCAGAAAAAAAAAAGGGG + Intronic
1129755153 15:78093630-78093652 CTGTGTCTGAAGCAGCTAAAAGG - Intronic
1133315103 16:4878066-4878088 CTATTTCAGAAGATGCTAAGGGG - Intronic
1133747701 16:8699829-8699851 CTGTCTCAAAAGAAAGAAAGAGG - Intronic
1135817605 16:25649826-25649848 CTGTCCCATCAGAAACTAAGTGG - Intergenic
1136708847 16:32216169-32216191 CTGTCTCAAAAGAAAAAAAGTGG + Intergenic
1136759061 16:32713239-32713261 CTGTCTCAAAAGAAAAAAAGTGG - Intergenic
1136809046 16:33157147-33157169 CTGTCTCAAAAGAAAAAAAGTGG + Intergenic
1136815522 16:33267227-33267249 CTGTCTCAAAAGAAAAAAAGTGG + Intronic
1138845679 16:60562945-60562967 CTGTCTCAGAAGGATGAAAGGGG - Intergenic
1139830223 16:69791526-69791548 CTGTCTCAAAAAAAGAAAAGAGG - Intronic
1141031158 16:80590127-80590149 CTGTCTCAGAAAAAGAAAACGGG + Intergenic
1141090228 16:81125122-81125144 CTGTCTCAAAAGAAGAAAAAAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141513348 16:84526672-84526694 TTTGCTCAGAAGAACCTAAGAGG + Intronic
1203061218 16_KI270728v1_random:973553-973575 CTGTCTCAAAAGAAAAAAAGTGG - Intergenic
1145365090 17:22255637-22255659 CTGTTTTAGTAGAATCTAAGAGG - Intergenic
1145410662 17:22658915-22658937 CTCTTTTAGTAGAAGCTAAGAGG - Intergenic
1146631224 17:34471125-34471147 CAGTGTCAGAAGAAGAGAAGAGG - Intergenic
1147304077 17:39551230-39551252 CTGTCTTAGAAGCAACTTAGGGG + Intronic
1150091784 17:62332752-62332774 CTGTCTCAAAAGAAAAGAAGAGG + Intergenic
1152533618 17:80937542-80937564 CTGTCTGAGTGGAAGCCAAGAGG + Intronic
1156097380 18:33551676-33551698 TTGTATCAGAAAAAGCTAATTGG - Intergenic
1157074576 18:44451069-44451091 CTTACTCAGGAGAAGGTAAGTGG - Intergenic
1158561233 18:58515505-58515527 CTGCCTTAGGAAAAGCTAAGTGG + Intronic
1166834755 19:45660540-45660562 CTGTCTCAAAAGAAAAGAAGAGG + Intergenic
1167500896 19:49847164-49847186 CTGTCTCAAAAAATGCTAATAGG - Intergenic
1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG + Exonic
1167608040 19:50492286-50492308 CTGTGTCAGAAGGAGACAAGGGG - Intergenic
1167903051 19:52636658-52636680 CTGTCTCAAAAGAAAAAAAGGGG - Exonic
1167940237 19:52940954-52940976 CTGTCTCAAAAGAAAAAAAGGGG - Intronic
1167946297 19:52991920-52991942 CTGTCTCAAAAGAATAAAAGGGG - Intergenic
1168000295 19:53440322-53440344 CTGTCTCAAAAGAATAAAAGGGG + Intronic
1168004786 19:53477814-53477836 CTGTCTCAAAAGAATAAAAGGGG + Intronic
1168439505 19:56351771-56351793 CTGTCGCAGAACAAGAAAAGTGG + Intronic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
927282258 2:21319346-21319368 CCGTCTAAGAAGAATCAAAGTGG - Intergenic
928399888 2:30970196-30970218 CTGTCCCACAAGCAGGTAAGGGG + Intronic
930884986 2:56315047-56315069 CTGTGACAGATGAAGCAAAGGGG - Intronic
931408141 2:62001188-62001210 CTGTCTCAGAAGAACAGAATGGG + Intronic
931600544 2:63998949-63998971 CTGTCTTAAAAAAAGCTAAAGGG - Intronic
932454997 2:71843832-71843854 CTGCCTCAGAAGCAGGTAAGAGG - Intergenic
932840473 2:75077461-75077483 CTCTTCCAGAAGAAGCTGAGAGG + Intronic
936040362 2:109145178-109145200 CTGTCTCAGAAGCAGCAGAAAGG - Intronic
936469032 2:112781596-112781618 ATGACTCAGAGGAAGGTAAGGGG - Exonic
937494209 2:122400755-122400777 CTGTTTCAGAAGGGCCTAAGTGG + Intergenic
938488570 2:131742829-131742851 CTGTCACAGAAGGAGCAAGGGGG + Intronic
939673458 2:145042542-145042564 CTGCCTAAGAAGAAGATAAAAGG + Intergenic
940197445 2:151111378-151111400 GTGTGACAGACGAAGCTAAGAGG + Intergenic
940271116 2:151891352-151891374 CTTTCTCAGAAGTGGCTAAATGG - Intronic
941632776 2:167903063-167903085 CTGTCTCAGAAAAAGTTCACAGG + Intergenic
942801527 2:179881713-179881735 CTGCCTCAGAGGCAGCTATGAGG - Intergenic
943646896 2:190415996-190416018 CTGTCTTAGAACAAGCCCAGCGG - Intronic
944180729 2:196889936-196889958 CTGTCTCAGAAGAAAAAAAAGGG - Intronic
947900051 2:233713695-233713717 CTCTCTCTGAAAAAGCTCAGAGG - Exonic
947900760 2:233719524-233719546 CTCTCTCTGAAAAAGCTCAGAGG - Exonic
947902133 2:233729830-233729852 CTCTCTCTGAAAAAGCTCAGAGG - Exonic
1169095012 20:2889886-2889908 CTGTCTCAAAAAAAGGTATGGGG - Intronic
1170978236 20:21186901-21186923 TTGTCTAAGAAGCTGCTAAGAGG - Intronic
1171541057 20:25956702-25956724 CTGTCTCAGCCAAAGGTAAGGGG - Intergenic
1171541912 20:25965874-25965896 CTCTTTTAGTAGAAGCTAAGGGG - Intergenic
1171799139 20:29594438-29594460 CTCTTTTAGTAGAAGCTAAGAGG + Intergenic
1171844075 20:30253074-30253096 CTGTCTCAGCCAAAGGTAAGTGG - Intergenic
1171844912 20:30262030-30262052 CTCTTTTAGTAGAAGCTAAGAGG - Intergenic
1172076085 20:32298683-32298705 CTGTCTCTGAAGAAGGGAAGGGG - Intronic
1172638622 20:36427176-36427198 CTGTCTCAAAAGAAAGAAAGAGG + Intronic
1173132223 20:40404983-40405005 CTGTCTCAGAGGCAGCTGAGAGG + Intergenic
1173313451 20:41921346-41921368 CTGTCTCTGATGAGGCTATGAGG + Intergenic
1174280717 20:49437267-49437289 CTGAGCCAGAGGAAGCTAAGAGG + Intronic
1177355487 21:20000727-20000749 ATGTATCAGAAGAAGTTAATTGG - Intergenic
1178635628 21:34299809-34299831 TTATCTCAGAAGAAGGAAAGAGG + Intergenic
1178717440 21:34979001-34979023 CTGTCTCATAAGAACCTACCTGG - Intronic
1178911394 21:36676647-36676669 TTGTCTCTGAAGAATCTAAATGG + Intergenic
1180289887 22:10839271-10839293 CTGTCACAGAAGGAGCAAGGGGG + Intergenic
1180492684 22:15868693-15868715 CTGTCACAGAAGGAGCAAGGGGG + Intergenic
949737981 3:7196476-7196498 CTGTCTTTGAAGCAGGTAAGTGG - Intronic
950614037 3:14145442-14145464 CTGACTCAGGGGAAGGTAAGTGG + Exonic
950719448 3:14872133-14872155 ATGCCACAGAAGAAGCTAATGGG + Intronic
952441585 3:33335843-33335865 CTGTCTCAGAAGAAGCGGGCAGG + Intronic
953910059 3:46888107-46888129 CTGTCTCATAGGATGTTAAGAGG + Intronic
954111546 3:48436364-48436386 CTGTCTTTGGAGAAGCTCAGCGG + Intronic
956615465 3:71166978-71167000 CTGTCACAGAACAAGATAACCGG - Intronic
959930974 3:111981837-111981859 CTGGCTTATAAGAAGCTAAAAGG + Exonic
962313435 3:134342210-134342232 CTCCCTCTGAAGATGCTAAGGGG - Intergenic
964670074 3:159215276-159215298 CTGTCTCTGAAGAGGAAAAGAGG - Intronic
967120074 3:186374862-186374884 ATGACTCAGAACAAGGTAAGAGG - Intergenic
967298771 3:187991493-187991515 CTGACCCTCAAGAAGCTAAGTGG - Intergenic
967574189 3:191070968-191070990 ATATCTCAGAAGAATTTAAGTGG - Intergenic
968125725 3:196158830-196158852 CTGTCTCAGAAAAAAAAAAGAGG - Intergenic
968215370 3:196885220-196885242 ATTTCTCAGAAAAGGCTAAGTGG - Exonic
969884867 4:10206384-10206406 CTGACTATGAAGAAGCCAAGAGG - Intergenic
971398982 4:26257623-26257645 CTGTCTCAAAAAAAGAGAAGTGG + Intronic
971762983 4:30792705-30792727 CTATCTCAGTAGGAGCTGAGGGG + Intronic
972610369 4:40650612-40650634 CTGTCTCAAAAGAAGAAGAGAGG - Intergenic
974060302 4:57027311-57027333 CTGTCTCAAAAAAAGGGAAGGGG - Intronic
975372070 4:73600472-73600494 CTGTCTCATAAGAAAATGAGAGG + Intronic
976221798 4:82762165-82762187 CTGTCTCAAAAGAAGAGGAGAGG + Intronic
977172390 4:93779499-93779521 CTTTCTCAGGAGAAGCTGGGTGG - Intergenic
978902037 4:113962911-113962933 CTGTCTCTGAACTAGCTTAGTGG + Intronic
979396311 4:120193710-120193732 CTGTCTCAAAAAAAGATAATAGG - Intergenic
980899860 4:138894685-138894707 CTGGCTCAGATGAAGATTAGTGG + Intergenic
981324335 4:143428589-143428611 GCAGCTCAGAAGAAGCTAAGGGG - Intronic
981617712 4:146658905-146658927 CTGTCTAAGAAACAGGTAAGTGG + Intergenic
982070358 4:151688846-151688868 CTGTCTCAGAGGAGGCAGAGGGG - Intronic
982155277 4:152514193-152514215 CTGTCTCAGAAGAAGCTAAGTGG + Intronic
982463354 4:155699170-155699192 CAGTCTGAAAAGAAGCAAAGAGG - Intronic
983759327 4:171385530-171385552 CTGTCTCAAAAAAAGAAAAGCGG - Intergenic
984486500 4:180376888-180376910 CTGTCTCAAAACAAGATAAAAGG + Intergenic
988501977 5:31791116-31791138 CTTTATCAGAAGCAGATAAGTGG - Intronic
988815543 5:34830748-34830770 CAGTCTCAAAAGAAGTAAAGTGG + Exonic
990296359 5:54405683-54405705 CTTTGTCAGAAGAGGCTGAGTGG + Intergenic
992082620 5:73249324-73249346 GTGTCTCAGAAGATGATAGGTGG + Intergenic
994201955 5:96986700-96986722 CTGTGTCACAAGAGGCTCAGAGG + Intronic
995274192 5:110259576-110259598 AGGGCTCAGAACAAGCTAAGGGG - Intergenic
996054779 5:118970419-118970441 CTGTCTCAGAAAAAGAAAAAAGG + Intronic
998608986 5:143667093-143667115 TTGTCTAAGAAGAAGCTAACAGG + Intergenic
1000166812 5:158657661-158657683 CAGTCTCATAAGAAGCCAACAGG - Intergenic
1000819004 5:165960410-165960432 CTGTCTCAAAAGAAGAAAAAAGG - Intergenic
1004131789 6:12927861-12927883 CTGTCTCATGAGAGTCTAAGAGG + Intronic
1004921350 6:20379073-20379095 CTGTCTCAGACGAAGAGAAGGGG + Intergenic
1005310364 6:24553252-24553274 CTATCTCACAAGTACCTAAGTGG - Intronic
1005465584 6:26109339-26109361 CTGTTCCAGTAGAAGCTCAGGGG - Intergenic
1005958029 6:30678209-30678231 CTGTCTCAAAAGAAACAAACAGG - Intronic
1009755770 6:67938169-67938191 CTGTGTCAGAAGAAAGCAAGTGG - Intergenic
1009901609 6:69813754-69813776 CTGTCTCAGAAGGAGGTTACTGG + Intergenic
1010606385 6:77893769-77893791 CTGTCACAGAAAAAGCCAAATGG - Intronic
1012914656 6:105156580-105156602 CTGTCTCAGATGTGGCTGAGAGG - Intergenic
1012956762 6:105579396-105579418 CTATCTCAGAAGAAACCAGGTGG - Intergenic
1013124585 6:107170618-107170640 CTGTCTCAGAAAAAAAAAAGTGG - Intronic
1013233608 6:108177297-108177319 CTGCCTCAGAAGTAGGTGAGGGG - Intronic
1015988449 6:138910357-138910379 CTGTCTCAAAAAAAGAAAAGAGG - Intronic
1016942135 6:149491511-149491533 TTGTCACAGAAGAACCTAATAGG + Intergenic
1017599707 6:156067398-156067420 CTGTCTCTGGACAAGCAAAGAGG + Intergenic
1019025906 6:168962787-168962809 TTGTCTCTGAAGAAGTTAAGCGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1023587367 7:41744495-41744517 CCGTAACAGAAGATGCTAAGTGG - Intergenic
1023845006 7:44115634-44115656 CTGTCTGAGGAGAAGTTCAGAGG - Intronic
1024594178 7:50918212-50918234 CTGTAGCAGCAGAAGCTAACTGG + Intergenic
1025292492 7:57742964-57742986 CTGTCTCAGCCAAAGGTAAGAGG - Intergenic
1025293369 7:57752200-57752222 CTCTTTTAGTAGAAGCTAAGAGG - Intergenic
1026079535 7:67205435-67205457 TGGTGTCAGAAGAAGCTTAGTGG - Intronic
1026697312 7:72606547-72606569 TGGTGTCAGAAGAAGCTTAGTGG + Intronic
1027837989 7:83270516-83270538 CTGGGTCAGAAAAAGCCAAGTGG + Intergenic
1030382800 7:108831908-108831930 CTGCCTCAGAAGAAGCTATGTGG - Intergenic
1031010506 7:116521743-116521765 ATGTCTCAGAAGTTGCTAACGGG + Intergenic
1032077511 7:128843085-128843107 GTGCCTCAGAGGAAGCAAAGGGG + Intronic
1032822247 7:135534779-135534801 CTGTCTCAAAAGAAGATGGGAGG + Intergenic
1033656060 7:143375439-143375461 CTGTCTCAGAAAAAGGGAACAGG - Intergenic
1034589918 7:152130287-152130309 GTGTCCCAGAAGAGGCTAAGAGG + Intergenic
1034887376 7:154808344-154808366 CTGTCTTAGAAGAATGTCAGGGG - Intronic
1034937681 7:155210366-155210388 CCGTCCCAGAAGATGCTAAGAGG - Intergenic
1035146641 7:156824290-156824312 CAGTCTCAGCAGAAGCTTACGGG + Intronic
1035474921 7:159136546-159136568 CTGCCCCGGAAGAAGCTGAGAGG + Intronic
1035948740 8:3994853-3994875 CACTCTCAGAAGAAGCTACTTGG - Intronic
1036765375 8:11546577-11546599 CTGTCTCAAAAAAAACCAAGTGG - Intronic
1038882824 8:31633730-31633752 ATGTGTCTGAAGAAACTAAGGGG - Intergenic
1039427309 8:37496301-37496323 CAATCTCAGGAGAAGATAAGGGG - Intergenic
1040466561 8:47700956-47700978 GTGTCTCAGAAGCAGCAAAATGG + Intronic
1040914990 8:52559637-52559659 CTGTTTCAGAACCAGCTGAGAGG - Intronic
1041595726 8:59649110-59649132 GTGACTCAGAAAAACCTAAGAGG - Intergenic
1042553401 8:70014098-70014120 CTGTCTCAGAAAAAGAAAAAAGG + Intergenic
1043101810 8:76056682-76056704 CTTTCCCAAAAGAAGCAAAGAGG + Intergenic
1046315984 8:112502239-112502261 CTGTATCAGAAGATGCTTGGGGG - Intronic
1046639680 8:116714428-116714450 CTGCCTCAGAAGATTTTAAGTGG - Intronic
1051115320 9:13687448-13687470 CTGTCTCAGAAAAAAAAAAGAGG + Intergenic
1052558462 9:30051412-30051434 CTATATCAGAAGAAGTTAGGAGG - Intergenic
1054163171 9:61693779-61693801 CTCTTTTAGTAGAAGCTAAGAGG + Intergenic
1054164023 9:61702754-61702776 CTGTCTCAGCCAAAGGTAAGAGG + Intergenic
1056340601 9:85627657-85627679 CTGTCTCAGCAGGGGCAAAGGGG - Intronic
1057186372 9:93059377-93059399 CTGTCTCGGAGGAGGCTCAGAGG + Intronic
1057755453 9:97831571-97831593 CTGTCTCCCAGGCAGCTAAGGGG + Intergenic
1058956565 9:109954192-109954214 CAGTCTCTGAAAAAGCAAAGGGG + Intronic
1059801137 9:117750582-117750604 CAGTCACAGATGAAGATAAGGGG - Intergenic
1060739536 9:126089187-126089209 CAGCACCAGAAGAAGCTAAGAGG - Intergenic
1060871049 9:127040395-127040417 CTGTCTCAGAAGAAAAGAAAAGG + Intronic
1062575760 9:137206723-137206745 CTGTAGCAGAAGCAGCTAACGGG + Intronic
1203489638 Un_GL000224v1:91645-91667 ATGTCTTTTAAGAAGCTAAGAGG - Intergenic
1203502260 Un_KI270741v1:33533-33555 ATGTCTTTTAAGAAGCTAAGAGG - Intergenic
1186556477 X:10565412-10565434 CTGTCACAGAATAAACTATGTGG + Intronic
1186808124 X:13160600-13160622 CTGTCTCAGAAAGAGGTATGAGG + Intergenic
1186895344 X:13999657-13999679 CTGTCACAGAGGAGACTAAGGGG - Intergenic
1186917859 X:14243405-14243427 CTGTCTCAAAGGCAGTTAAGTGG + Intergenic
1187242262 X:17523919-17523941 TCATCTCAAAAGAAGCTAAGAGG + Intronic
1187371555 X:18712185-18712207 GTGTCTCAAAAGAAGCCAAGTGG + Intronic
1187751587 X:22471624-22471646 CTCTCTAAGAAGAACCTAAAGGG - Intergenic
1187809621 X:23160843-23160865 CTGTGAAAGAAGCAGCTAAGGGG - Intergenic
1189144536 X:38642396-38642418 TTGACTCAGAAAAAGCTGAGAGG + Intronic
1191672878 X:63765296-63765318 CTTTCTGAGAAGCAGCTGAGGGG - Intronic
1191857989 X:65643063-65643085 CTGACTCAGAAGAAGGGAAGAGG - Intronic
1191891583 X:65948541-65948563 CAGTATCAGAAGAAGAAAAGGGG - Intergenic
1196914405 X:120517331-120517353 CTGTCTCAAAAAAAGAAAAGAGG + Intergenic
1198430238 X:136558197-136558219 CTGTCTCTGAAAAAGCAAAAAGG + Intergenic
1200163649 X:154021383-154021405 CTGGCTTGGAAGAAGCTGAGGGG + Intergenic
1201706246 Y:16940255-16940277 CTGTCTCAAAAGAAGAGATGAGG + Intergenic