ID: 982156817

View in Genome Browser
Species Human (GRCh38)
Location 4:152531596-152531618
Sequence AGCACTACTGTGCCTACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982156817 Original CRISPR AGCACTACTGTGCCTACACA GGG Intronic
908340056 1:63168917-63168939 ATCACTGCTGTGCACACACAGGG - Intergenic
912034901 1:105300828-105300850 ACCACCACTGTGACTACACTGGG + Intergenic
912314587 1:108656260-108656282 ACCACTACTGTTTCTACACTTGG - Intronic
917381746 1:174418438-174418460 AGCATTAATGTGCCATCACAGGG - Intronic
918377891 1:183927452-183927474 AGCATTACTGTGCCTAGTCGTGG + Exonic
920823167 1:209400453-209400475 TGCAGTACTGTGCCTCCCCAGGG - Intergenic
924516077 1:244767639-244767661 ACCACTACTGTGACTGCACCAGG + Intergenic
1066370120 10:34813718-34813740 AGCCCTATTGAGCGTACACAGGG - Intronic
1073272278 10:102275453-102275475 AGGAATACTATTCCTACACAAGG - Intronic
1073572538 10:104592651-104592673 GGCACTACTGTACCCACATAAGG - Intergenic
1074320308 10:112395795-112395817 AGCATTCCTGTTCCTTCACAAGG + Intronic
1074519202 10:114202041-114202063 AGCACACCTGTGCACACACAGGG + Intronic
1086517803 11:87633837-87633859 ATCACTACTGTTTCCACACAAGG + Intergenic
1092748360 12:11694556-11694578 GGCACCACTCTGCCTAAACATGG + Intronic
1097241525 12:57578778-57578800 TGCACCACTGTGCCTAGCCAGGG - Intronic
1104901654 12:132192603-132192625 AGCACTCCTGTGCCCACTTAAGG - Intergenic
1106982784 13:35309197-35309219 AGACCTAATGTGACTACACAAGG - Intronic
1107286013 13:38793140-38793162 AGCACCTGTGTGCCTGCACATGG + Intronic
1107896477 13:44969715-44969737 AGCACTACAGAGCCAACACATGG + Intronic
1108290184 13:48951790-48951812 AACACAACTGTGGCTACCCAGGG - Intergenic
1115110113 14:29811458-29811480 AGCACTACAGTCCCTACATAAGG + Intronic
1119327044 14:73766300-73766322 AGCTATACAGTGCCTGCACATGG + Intronic
1125149242 15:36512641-36512663 AACAATACTGTGCCTACACATGG + Intergenic
1125715091 15:41815196-41815218 AGCAGTCCTCTGCCTACCCAAGG - Intronic
1127325923 15:57895503-57895525 AGCACTTCTTTGCCTAGATAAGG + Intergenic
1128032696 15:64495659-64495681 AGCACTTCTGGGCCTCCACCTGG - Intronic
1138434903 16:56992282-56992304 AGCAGTACTGTGACAACACTAGG + Intronic
1146070047 17:29672104-29672126 TGCACTACAGAGCTTACACAAGG - Exonic
1149328920 17:55561395-55561417 AGCGCTACTGCACCTACACCGGG - Intergenic
1156060990 18:33076045-33076067 AGAAATACAGTGCCTACAAAGGG - Intronic
1158264701 18:55649259-55649281 AGAAAGACTGTGCATACACACGG - Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160090832 18:75825270-75825292 AGCACCACTGTGCAAAAACAAGG + Intergenic
1165840165 19:38784130-38784152 TGAACTACTGTGCCTAGCCAAGG - Intergenic
925365630 2:3309923-3309945 TGCACACCTGTGCGTACACAGGG - Intronic
927403958 2:22746936-22746958 GGCACTACTGTTCCTACTTATGG + Intergenic
928235458 2:29535569-29535591 GGCAGTACTGTGCCTGCTCAAGG + Intronic
933815913 2:86068774-86068796 TGCACCACTGTGGCTTCACAAGG - Intronic
934765972 2:96880252-96880274 AGCCCTCCTCTGCCTGCACAGGG - Intronic
937525743 2:122767518-122767540 AGCTAAACTTTGCCTACACATGG + Intergenic
942736021 2:179113943-179113965 AGCAGTACTGTGATTACACAGGG + Intronic
942948075 2:181691255-181691277 AGCTCTAGTCTGCTTACACAAGG + Intergenic
943402907 2:187438556-187438578 AGCACTAAAGAGCCTATACAAGG - Intronic
943585588 2:189735435-189735457 AGCACTAATGTGCCTCTGCAGGG - Intronic
1168954942 20:1828190-1828212 AGCACTGCTGGGCCAAGACAAGG - Intergenic
1172173320 20:32957756-32957778 GGCACTCCTGAGTCTACACACGG - Intronic
1173353985 20:42269957-42269979 AGCACTCCTTTGGCTGCACATGG + Intronic
1175539409 20:59738944-59738966 AGCAAGACTGTGACTCCACATGG - Intronic
1175702788 20:61152641-61152663 AGGAATGCTGTGCCTTCACATGG + Intergenic
1176050912 20:63119350-63119372 CCCACAACTGTGCCAACACAGGG + Intergenic
1178190956 21:30280348-30280370 AGGACTACTGTGTGTACAAAGGG - Intergenic
1178432647 21:32529987-32530009 AGCACTTCTCTGCCCACACCTGG - Intergenic
1180744187 22:18075997-18076019 AGCACTATTATGCCCACAAATGG - Intergenic
1180790482 22:18573103-18573125 AGCCCCACTGTGTCCACACAAGG + Intergenic
1181231256 22:21422212-21422234 AGCCCCACTGTGTCCACACAAGG - Intronic
1181247395 22:21512656-21512678 AGCCCCACTGTGTCCACACAAGG + Intergenic
1185048005 22:48538582-48538604 AGCATGACTGTGCCTGCTCATGG + Intronic
1185207450 22:49548193-49548215 AGCACGACTCTGCCGACAGAAGG - Intronic
949231739 3:1757712-1757734 ACCAGAAGTGTGCCTACACATGG - Intergenic
955120605 3:56054239-56054261 AGCAGGACTGTGCCCACACATGG + Intronic
955631787 3:60982374-60982396 TGCACTTCAGTTCCTACACATGG + Intronic
960946644 3:122971404-122971426 GGCACTAATGTGCCCACTCATGG + Intronic
964211371 3:154232202-154232224 AGCACTTCTGTGGCTGCTCATGG - Intronic
964303463 3:155315149-155315171 TGTACTATTGTACCTACACAAGG - Intergenic
966702957 3:182876657-182876679 AGGATTACTGTGTCCACACATGG + Intronic
967387786 3:188928028-188928050 GGCAAGACTGTGCCTACATAGGG - Intergenic
968574263 4:1357726-1357748 AGCACTCCTGAGCCCACACACGG - Intronic
968959017 4:3733431-3733453 AGCACTCCTGTGTCCACACCTGG - Intergenic
969155135 4:5203522-5203544 AGCACTGCTGTGACTGTACAGGG + Intronic
969696093 4:8735679-8735701 CACAGAACTGTGCCTACACAGGG + Intergenic
975532300 4:75412984-75413006 AACACTACAGTGCCTACAACAGG - Intergenic
976894881 4:90097360-90097382 AGGAGCACTGTGCCTTCACATGG + Intergenic
977434468 4:96975887-96975909 AGCACTAATGTGCCTTCTGAAGG + Intergenic
979303330 4:119112500-119112522 AACTCTACAGTGCCTTCACAGGG - Intergenic
979518275 4:121636273-121636295 AGGACAAGTGTGTCTACACAGGG - Intergenic
980535193 4:134111159-134111181 AGAAATACTGTGTCTTCACAAGG + Intergenic
980624251 4:135352497-135352519 AGCACTACTTTGCATACATGAGG - Intergenic
982156817 4:152531596-152531618 AGCACTACTGTGCCTACACAGGG + Intronic
987454452 5:18125877-18125899 AGCACTACTGTGCCTATTTGTGG + Intergenic
989434233 5:41392093-41392115 AGCACTTCTGGACCTACCCAAGG + Intronic
994769056 5:103957986-103958008 ATCACTTCTGTTCATACACAAGG - Intergenic
995397902 5:111707713-111707735 AGCCCTCCTGTGAATACACATGG - Intronic
995844439 5:116478887-116478909 AGCACTAGTGTGGCTCCAAAGGG + Intronic
998707586 5:144781233-144781255 GGCACTACTGTTCCTAAAGACGG - Intergenic
1000017469 5:157290626-157290648 ACCATTATTCTGCCTACACAGGG + Intronic
1000564024 5:162825638-162825660 TGGACAACTGTGTCTACACATGG - Intergenic
1001580456 5:172794603-172794625 AGCACTAGTGTGCCTAGGTAGGG - Intergenic
1002834619 6:855699-855721 AGGACTCCTGAGCCCACACAAGG - Intergenic
1003564730 6:7213528-7213550 AGAACTAGAGGGCCTACACAGGG - Intronic
1007903929 6:45439934-45439956 AGCACTTCTCTGCCTTTACAAGG - Intronic
1010117109 6:72326832-72326854 AGCACTCCTGTTACTACACTGGG - Intronic
1010260639 6:73811964-73811986 AGCACTAATGTGCCCTCCCATGG + Intronic
1010581301 6:77599892-77599914 AGAATTACTGTGCCCAGACAAGG + Intergenic
1010846819 6:80719971-80719993 AGCACTGGTGTGCCTGCACTGGG + Intergenic
1021183213 7:17532813-17532835 CGCACTACTGTGTCTCCAAATGG + Intergenic
1024298619 7:47866635-47866657 ATCATTACTGTTCCAACACACGG + Intronic
1024412183 7:49057135-49057157 AGGACTACTGTGACTACTCTGGG + Intergenic
1024498423 7:50072556-50072578 ACCACTACTGTGACTACACTGGG - Intronic
1026498295 7:70921994-70922016 AGCACTGCGGTTCCAACACACGG - Intergenic
1030065337 7:105655119-105655141 AGCACTTCTGTGACTTCACAAGG + Intronic
1031349107 7:120706448-120706470 AGCAATTCTGTGTCTTCACATGG + Intronic
1032359797 7:131244748-131244770 AGGACCCCTGTGCCAACACAGGG - Intronic
1035667955 8:1392735-1392757 ATCACTACTGTGCCATCACCTGG - Intergenic
1035668412 8:1396724-1396746 ATCACTACTGTGCCATCACCTGG - Intergenic
1036028053 8:4932702-4932724 ATCACTTCTGTGCCAGCACATGG - Intronic
1039172141 8:34759821-34759843 AGCATTCCAGTGCCTACACAAGG + Intergenic
1040852646 8:51917104-51917126 AGCACTATTTTGATTACACATGG + Intergenic
1041097729 8:54366146-54366168 AGCACTACTGGAATTACACAAGG - Intergenic
1041827110 8:62108582-62108604 AGCACAACTGGACATACACATGG + Intergenic
1045040211 8:98216436-98216458 AGCACTTGTGTGTCCACACAAGG - Intronic
1049395434 8:142398067-142398089 AGCACTGCTGTGCCTTCCCTTGG + Intronic
1049612474 8:143561940-143561962 AGCCCTTCTGTCCCTACAGATGG + Exonic
1050914047 9:11108647-11108669 ACCACTACTATGACTACACTGGG - Intergenic
1060136108 9:121155689-121155711 GCCACTGCTGTGGCTACACATGG + Intronic
1188304950 X:28550523-28550545 AGTACCACTGTGACTAAACAGGG - Intergenic
1189386533 X:40541321-40541343 AGGAATACTGTGTCTTCACATGG + Intergenic
1190217718 X:48491110-48491132 AGGACTAATGTGCACACACATGG - Intergenic
1190434809 X:50413250-50413272 AGAACTACTGTGATAACACAAGG + Intronic
1191207228 X:57847956-57847978 AGCACTTCTGGACCCACACAGGG + Intergenic
1191207361 X:57849172-57849194 AGCACTTCTGAGCCCACACAGGG - Intergenic
1193738349 X:85186571-85186593 AGCACCACTGTGTCCACAGAGGG - Intergenic
1201405201 Y:13642969-13642991 AGCACTTCTGGACCTACCCAGGG + Intergenic