ID: 982167124

View in Genome Browser
Species Human (GRCh38)
Location 4:152624051-152624073
Sequence CTGTTTAAGACAAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982167124 Original CRISPR CTGTTTAAGACAAAGGTGGA TGG (reversed) Exonic
902566552 1:17315191-17315213 GTGCTGAGGACAAAGGTGGATGG - Intronic
903556076 1:24194350-24194372 CTGGTTAAGACACAGGTTGCTGG + Intergenic
904992183 1:34601982-34602004 CTTTTTAAGGCAAAGGAGTAAGG - Intergenic
905287098 1:36888615-36888637 GTGTTTAAGACAGAGGTGGCTGG - Intronic
906821308 1:48933345-48933367 GAGTTTAAGGCAAAGTTGGATGG - Intronic
908297674 1:62729228-62729250 CATTTTAACACAAAGGTGGTAGG - Intergenic
908323502 1:63000942-63000964 CTTTTTAAGGCAGAGGAGGATGG + Intergenic
908415789 1:63912041-63912063 CTTTGGAAGACCAAGGTGGAAGG + Intronic
908568320 1:65381858-65381880 ATGTTTAAGACAAAGCTGGTAGG + Intronic
908621525 1:65986582-65986604 CAGAATAAGACAAAGGAGGAGGG - Intronic
909031984 1:70552995-70553017 AAGTTTAAGACAAAGGTGGTTGG - Intergenic
917169470 1:172154582-172154604 CTGTTTAAAACTAAAGTGAATGG + Intronic
918191687 1:182181659-182181681 CTGTAATAGACAAAGGTGCAGGG - Intergenic
918213035 1:182368398-182368420 ATGTTTGAGGAAAAGGTGGAAGG + Intergenic
919128080 1:193420864-193420886 CTGTTTATGATTAAGCTGGAAGG + Intergenic
919399742 1:197097665-197097687 CTGATTAAGACTGAGGTGGCAGG - Intronic
919919111 1:202157876-202157898 CTGTTCTAGAAAAAGGTAGAAGG - Intronic
921084802 1:211779552-211779574 TTGTTTAAGACAAAGCAGGCTGG + Intronic
922374740 1:224951267-224951289 CTTTGGAAGACCAAGGTGGATGG - Intronic
924404351 1:243727012-243727034 CTGTTGAAGACCAAGGAGGTGGG - Intronic
924501137 1:244639217-244639239 GTGTTTCAGACAAAGGGAGAAGG - Intronic
924658849 1:245997764-245997786 CACTTTAGGACAAAGGGGGAAGG + Intronic
1065097645 10:22297436-22297458 CTTTGGAAGGCAAAGGTGGAAGG + Intergenic
1065699997 10:28415590-28415612 CTGGATACTACAAAGGTGGAAGG - Intergenic
1065769027 10:29059536-29059558 ATCTTTAAGACAGAGCTGGAAGG - Intergenic
1067395299 10:45910497-45910519 ATGAAAAAGACAAAGGTGGAAGG - Intergenic
1067863621 10:49879621-49879643 ATGAAAAAGACAAAGGTGGAAGG - Intronic
1070979064 10:80630022-80630044 CTGTGAAGGACAAAGGGGGAGGG + Intronic
1071390730 10:85172679-85172701 CTTTTGGAGACCAAGGTGGATGG - Intergenic
1072150501 10:92679105-92679127 TTGGTTCAGACAGAGGTGGAAGG - Intergenic
1072479064 10:95793136-95793158 CTGTTTCACACAATGGTGGGAGG - Intronic
1073200210 10:101729195-101729217 CTGTGAAAGACAAATGAGGAAGG + Intergenic
1073271230 10:102265935-102265957 CAGTGTAAGACTAAGGTGGAGGG + Intronic
1074333870 10:112548571-112548593 CTGATTAAGACCAGGGTGGCAGG + Intronic
1074960128 10:118437142-118437164 ATATTTAAGACACAGATGGAAGG - Intergenic
1076220646 10:128730651-128730673 CTGATAATGACACAGGTGGAAGG - Intergenic
1077499055 11:2900971-2900993 CTTCTAAACACAAAGGTGGAGGG + Intronic
1077946162 11:6901835-6901857 ATCTTAAAGACAGAGGTGGATGG + Intergenic
1078298847 11:10104362-10104384 CAGTTTGAAACAATGGTGGAAGG + Intronic
1079235530 11:18686555-18686577 CTGTTTAAGCAAATTGTGGAAGG + Intergenic
1079324835 11:19482768-19482790 CTGTTTAAGACATGGGTAAATGG + Intronic
1079481638 11:20886985-20887007 GGGTTTAATACAAAGGGGGATGG - Intronic
1080715092 11:34792452-34792474 CTTTTTAAGACACAGGTTGCTGG + Intergenic
1081300141 11:41441288-41441310 GTGTGACAGACAAAGGTGGAAGG + Intronic
1082957761 11:58888953-58888975 CTTTTTTAGACAATTGTGGAAGG + Intronic
1084854163 11:71970415-71970437 CTTTGGAAGACTAAGGTGGAAGG + Intronic
1085388704 11:76171435-76171457 CTGTTCAAGACCAGGGTGGATGG - Intergenic
1086702338 11:89913610-89913632 CTATTTCAGACAAAGGTGTCAGG - Intronic
1086703829 11:89930840-89930862 CTATTTCAGACAAAGGTGTCAGG + Intergenic
1086935018 11:92735762-92735784 CTTTAGAAGACATAGGTGGAGGG + Intronic
1089133397 11:116230056-116230078 ATGTTTAAGTGAAATGTGGAGGG + Intergenic
1090804576 11:130194886-130194908 GTGTGTGAGACAGAGGTGGATGG + Intronic
1090972699 11:131656635-131656657 CTGGTTTGGACAAAGGAGGAGGG + Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1092740873 12:11628251-11628273 CTTGTTAAGACATAGGTTGAAGG - Intergenic
1093462745 12:19421099-19421121 CTTTGGAAGACCAAGGTGGAAGG + Intronic
1097669172 12:62515570-62515592 CTTTGTAAGGCCAAGGTGGATGG + Intronic
1098397676 12:70039162-70039184 CTGTTTCAGGCAAAGGAGCAGGG + Intergenic
1098662665 12:73116998-73117020 ACGTTTAAGACAAACGTTGATGG + Intergenic
1099459324 12:82903230-82903252 CTCAGTAAGACAGAGGTGGAGGG - Intronic
1100431618 12:94535997-94536019 CTCTCTAAGAGAAAGGAGGATGG + Intergenic
1100452857 12:94724127-94724149 CTCTTTAAGGCAGAGGTGGGAGG + Intergenic
1100613372 12:96210745-96210767 CTGGTTAACAAAATGGTGGATGG + Intronic
1101233998 12:102769791-102769813 CTGTTCATGACAAAGGCAGATGG + Intergenic
1101569047 12:105936438-105936460 CTGGATAAAGCAAAGGTGGAAGG + Intergenic
1103113785 12:118307471-118307493 CTGTTTAAAACAAAGGCAGCAGG - Intronic
1103411920 12:120718337-120718359 CTGATTAAGAAAAAAGTGAAGGG - Intronic
1103793049 12:123485086-123485108 CTGTTGAATAGAAAGCTGGAAGG - Intronic
1105288678 13:19030680-19030702 CTGTATAATACAAAAGTGCAAGG - Intergenic
1105958101 13:25302650-25302672 TTTTTTAAGATAAAGGTGGAGGG + Intronic
1109031973 13:57202518-57202540 CTGTTTAATACACAGTTGGAGGG - Intergenic
1109356199 13:61231993-61232015 GTGTTTATGACAAAGGTAAAGGG - Intergenic
1109375764 13:61490612-61490634 CTCTGTAAAACAAATGTGGAAGG - Intergenic
1109556169 13:63978321-63978343 CAGTTTAAGACAAATGCTGATGG - Intergenic
1109741154 13:66557762-66557784 CTGATAAATACAAAGGTAGATGG + Intronic
1111846973 13:93522904-93522926 CTGAAGGAGACAAAGGTGGAGGG + Intronic
1114467047 14:22930551-22930573 CTGTGTAATAGAAAGTTGGATGG + Intergenic
1116644842 14:47514146-47514168 TTGTTTTTGAGAAAGGTGGAGGG + Intronic
1117432298 14:55679898-55679920 CTGTTTGATACAAAGGTCAAAGG - Intronic
1119191992 14:72689188-72689210 CTGCTGAAGACAAAGCTGGGGGG + Intronic
1120855538 14:89208873-89208895 ATGTTTAAGAGACAGGTGGAGGG - Intronic
1126235684 15:46381529-46381551 CTGTATAAGACAGAGGGGAAAGG + Intergenic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1127270953 15:57401533-57401555 ATGTTCAATTCAAAGGTGGATGG + Intronic
1127485431 15:59413770-59413792 CTGTTTAAGCCATTGGTAGATGG + Intronic
1129857759 15:78837208-78837230 CTTTTTGAGACCAAGGTGGGAGG - Intronic
1130433831 15:83875831-83875853 ATGTGTAAGACACAGGAGGAAGG + Intronic
1130857703 15:87855793-87855815 CTGTCTAAAACAACAGTGGAGGG - Intergenic
1135042093 16:19125452-19125474 CTTTTTGAGGCCAAGGTGGACGG - Intronic
1135222870 16:20628128-20628150 CATTTTAAGACAAATGTGGATGG + Intronic
1135380298 16:21990504-21990526 CTGCTTAAGACCAAAGTAGAAGG - Intronic
1137801422 16:51265652-51265674 CCTTATAAGAGAAAGGTGGAGGG - Intergenic
1141258027 16:82421676-82421698 GTGTTTAGGAGCAAGGTGGAAGG + Intergenic
1142330046 16:89446305-89446327 CAGTTTAACACTGAGGTGGACGG + Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1146062922 17:29616391-29616413 CTGTCTAAGACCAAGGGGGTTGG + Intronic
1146264666 17:31444449-31444471 CTGATTAAGCCAAAGGTGGCGGG + Intronic
1147177864 17:38667800-38667822 ATGCTTTAGACAAGGGTGGAGGG + Intergenic
1147343327 17:39768935-39768957 CTGTTTTTAACAAAGGGGGAAGG - Intronic
1148188254 17:45660281-45660303 CTGTTTTATGCAAATGTGGAAGG - Intergenic
1148394458 17:47296930-47296952 CTATTTAAGCGAAGGGTGGATGG - Intronic
1148540314 17:48475079-48475101 TTTTTAAAGAAAAAGGTGGAGGG - Intergenic
1148996424 17:51714208-51714230 CTCTTTAAGAAAGAGATGGATGG - Intronic
1149355535 17:55835400-55835422 ATTTTTAAGCCAAAGGTGAATGG - Intronic
1151213043 17:72559139-72559161 CTGTTTAGGACACAGATGGCTGG - Intergenic
1153451431 18:5234391-5234413 CTTTGGAAGACAAAGGTGGGAGG + Intergenic
1154374760 18:13799678-13799700 CTGGATGAGACAATGGTGGAGGG - Intergenic
1156017983 18:32567804-32567826 CTGTTTAAAAAAAAGGGGGGGGG - Intergenic
1156113955 18:33763601-33763623 CTGTTAAATACAAAGCTTGAAGG + Intergenic
1156700630 18:39820311-39820333 CTTTTTATGACAAAGGTCAATGG + Intergenic
1157619820 18:49010261-49010283 CTAATTCAGACAAAGGTGCATGG + Intergenic
1158138920 18:54236132-54236154 CTGTTTAAGACAAAGTGAGAAGG - Intergenic
1158520198 18:58165952-58165974 CTTCTTAAGACAAAGCTGGCTGG + Intronic
1158992953 18:62888982-62889004 CTGTTTCAGAGAAAGATAGAGGG - Intronic
1159580730 18:70232051-70232073 CTCTTTGAGGCCAAGGTGGAAGG - Intergenic
1161961089 19:7523464-7523486 CTGTTTACGACAAAGCCAGAGGG - Intronic
1162659372 19:12157008-12157030 CTGTGCAAGACAAAGGAGCAGGG - Intergenic
1164882943 19:31751143-31751165 CTTTTGAAGGCCAAGGTGGAAGG + Intergenic
1165026185 19:32963703-32963725 CTGTCTCAGACAAAGGAGTAAGG + Intronic
1166322422 19:42026862-42026884 CAGTTTAAGAACAAGGTGGCTGG - Intronic
1167036048 19:46995561-46995583 CTGGTGATGGCAAAGGTGGATGG - Intronic
1167381504 19:49140948-49140970 CTGTTTAAAAAATAGGTGGCTGG - Intronic
925282507 2:2694674-2694696 TGGTGTAAGACACAGGTGGAGGG + Intergenic
925696078 2:6580541-6580563 CTTGTGAAGACAGAGGTGGAGGG - Intergenic
925696092 2:6580732-6580754 CTTGTGAAGACAGAGGTGGAGGG - Intergenic
926582458 2:14646083-14646105 TTCTATAAGAAAAAGGTGGAGGG - Intronic
927748890 2:25648703-25648725 CTCTTTAAGAAAAAGATGGCTGG + Intronic
928411671 2:31059112-31059134 CTGTTTAAGCACAAGTTGGAGGG + Intronic
931393517 2:61865272-61865294 CTGAGTAAGAAAAAGGTGGCTGG + Intergenic
931620388 2:64204305-64204327 CTGTTTAAGAGAAATCTGAACGG - Intergenic
931814319 2:65885731-65885753 CTGTTTATGATAAAGCTGGAGGG + Intergenic
932335580 2:70929285-70929307 CTGCTTTAGAGAAAGGTGGCAGG - Intronic
932488307 2:72101050-72101072 ATGTTGAAGAGCAAGGTGGATGG - Intergenic
932972027 2:76555492-76555514 ATTTTTAAAACAAAGGTGGGAGG + Intergenic
935782400 2:106519662-106519684 CTGTGTTACACGAAGGTGGACGG - Intergenic
940378705 2:152988329-152988351 CTCTTTAAGAAAAAGTTGGCTGG + Intergenic
941222193 2:162796560-162796582 CTGTTTAAGACAAGGTGGGTAGG - Intronic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
942974278 2:181996270-181996292 CTGTGAAAGCCAGAGGTGGAGGG + Intronic
943960420 2:194256000-194256022 TTATTTAAAAAAAAGGTGGAGGG + Intergenic
944230029 2:197383227-197383249 CTTTGGAAGACCAAGGTGGAAGG + Intergenic
947512611 2:230771659-230771681 CTAATTAAAACAAAGTTGGAGGG + Intronic
1169754493 20:9029330-9029352 CTGATAAAGACAAAGTTGAAAGG - Intergenic
1169864674 20:10187085-10187107 CTTTGAAAGACCAAGGTGGAAGG + Intergenic
1169926080 20:10785613-10785635 CTTTGGGAGACAAAGGTGGAAGG - Intergenic
1170116160 20:12862413-12862435 CTGTAGCAGGCAAAGGTGGAAGG - Intergenic
1170155408 20:13264643-13264665 GTGTTTGTGACCAAGGTGGATGG - Intronic
1174603198 20:51741226-51741248 CAGTTCAAGAGTAAGGTGGAAGG - Intronic
1174883295 20:54304247-54304269 CTGTCTCAAAAAAAGGTGGATGG - Intergenic
1177356807 21:20019015-20019037 CTGTTTAATAGATAGGTAGATGG - Intergenic
1177741332 21:25157180-25157202 CTGTTGTAGCCAAATGTGGATGG - Intergenic
1179532552 21:42029941-42029963 CTATTTAAGACAGAGCTGAATGG - Intergenic
1181278291 22:21700819-21700841 ATATTGAAGACAAAGGTGAAAGG + Exonic
1181738483 22:24900888-24900910 CTATTTAAGACCCAGGTGGAAGG + Intronic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1184958694 22:47912602-47912624 CAGTTTAAGACTAAGGTGGCTGG - Intergenic
949221648 3:1641725-1641747 TTGTATAAGACAAATGGGGAAGG + Intergenic
950139699 3:10607026-10607048 GTTTTTAAGACAAAGGTTGATGG - Intronic
950337491 3:12208764-12208786 CTGATAAAGACAAATGTTGAAGG - Intergenic
953227558 3:41034365-41034387 CTGTGAAAGATAAAGGTAGAGGG - Intergenic
953393329 3:42546889-42546911 CTTCTTAAGTCAAATGTGGACGG - Intergenic
953792279 3:45957135-45957157 CGGTTTTTGACAAAGGTGCAAGG + Intronic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
957201607 3:77143148-77143170 CTGTTTAAGAAAATGGTGTCTGG - Intronic
957508465 3:81155991-81156013 CTCTTTAAGGCAGAGTTGGATGG - Intergenic
958798900 3:98733570-98733592 CAGTTTAGGAGAAAGGAGGACGG + Intronic
962792744 3:138826345-138826367 CTGATTAAGACTCAGGTGGCAGG - Intronic
964606673 3:158567594-158567616 CTGTTTAAGACAAAGGGATTAGG + Intergenic
965763464 3:172106164-172106186 CTCTTTAAAAAAAAGGTTGATGG - Intronic
965797765 3:172459124-172459146 CTGTTTAGGAGAAAGATGAAAGG + Intergenic
965888287 3:173476960-173476982 CTGATTAAGATAAAGAAGGAAGG + Intronic
967269293 3:187719772-187719794 CTGTTTAATAGAGAGATGGAGGG - Intronic
967866594 3:194194954-194194976 CTGTTCAGGACAGAGGTGGGAGG + Intergenic
968825236 4:2891150-2891172 CTTTTTAAGATAAAGGAGGCTGG + Intronic
970170159 4:13281419-13281441 CTGGTCAAGACACAAGTGGAGGG + Intergenic
972292584 4:37703704-37703726 CTGTTGAAGACAAGGGAGGCAGG - Intergenic
973127493 4:46605840-46605862 CTTTATAAGAGAAAGGTAGAGGG + Intergenic
973715473 4:53671352-53671374 CTGTGAAAGATAAAGGAGGAAGG - Intronic
974297825 4:60025545-60025567 CTGTGGAAGACCAAAGTGGAAGG - Intergenic
976299923 4:83507733-83507755 CTGTTTAAGGGTAATGTGGACGG + Intronic
977140789 4:93369273-93369295 TTGTTTAAGACTATGGTAGAGGG - Intronic
979006091 4:115299004-115299026 CTTTTGAAGGCCAAGGTGGAAGG - Intergenic
980323349 4:131307857-131307879 CTTTGTGAGACCAAGGTGGACGG - Intergenic
980490417 4:133518327-133518349 ATGTCTAAGACAAAGATGGATGG + Intergenic
981454804 4:144941104-144941126 AGGTCTAAGACAAAGGTGAAGGG - Intergenic
982167124 4:152624051-152624073 CTGTTTAAGACAAAGGTGGATGG - Exonic
983501641 4:168506242-168506264 CTGTTGTAGAAAAAGGGGGAAGG - Intronic
983894684 4:173069465-173069487 CTTTCTCAGACAAAGGTTGAGGG - Intergenic
986759780 5:10869371-10869393 CTATTTTAGGGAAAGGTGGATGG + Intergenic
988561306 5:32284056-32284078 CTGTTGGAGGCCAAGGTGGATGG + Intronic
990372535 5:55135391-55135413 CTGTTTAGGACAAAAGACGAGGG + Intronic
993396939 5:87401307-87401329 TTTTTTAAGAGAAAGGTAGAAGG - Intronic
994367777 5:98934845-98934867 CTGTATAAGAATTAGGTGGAAGG + Intergenic
1002472205 5:179442203-179442225 CTGCTAAAGATAAAGATGGATGG + Intergenic
1003348020 6:5288779-5288801 CTTTTTAAGACATAGGTGAGAGG + Intronic
1006742838 6:36321630-36321652 CTGCTTAGAACACAGGTGGATGG - Intronic
1007502858 6:42312085-42312107 CAGCTTAAAACCAAGGTGGATGG - Intronic
1007601934 6:43087617-43087639 CAGTTTTAGGCAAATGTGGAAGG - Intronic
1007943910 6:45808180-45808202 CTGTGTGAGACAGAAGTGGAGGG - Intergenic
1008871944 6:56282665-56282687 TTGTGTAAGACAAAGGTGTCTGG - Intronic
1009688418 6:66993115-66993137 TTTTTTAAGACAAAACTGGACGG - Intergenic
1011524224 6:88245906-88245928 CTGTCTTTGATAAAGGTGGAAGG + Intergenic
1011612921 6:89170925-89170947 CTGTGAATGACAAAGGTGTATGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013535098 6:111056718-111056740 TTGTTGAAGAGAAATGTGGATGG - Intergenic
1014943166 6:127466808-127466830 CTGTTTATAAGAAAGATGGAAGG + Intronic
1015222814 6:130824409-130824431 TTGTTTAAGACATAGGAGGAAGG - Intergenic
1015547181 6:134373326-134373348 CTGTTTTATACAAAGTTGTAGGG + Intergenic
1015809112 6:137143424-137143446 CTTGTTAAGACAAAACTGGAGGG + Intergenic
1017290778 6:152733401-152733423 ATGTTTAAGAAAACCGTGGAAGG - Intergenic
1019684234 7:2371754-2371776 CTGTTTAAAAAAAAGGGGGAAGG - Intronic
1021879091 7:25076589-25076611 ATATTCAACACAAAGGTGGAAGG - Intergenic
1022155357 7:27656054-27656076 CTCTTTAAGACAAAGTTGGCTGG - Intronic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1024485263 7:49910458-49910480 CTGTTGAAGATAAAAGTTGAGGG + Intronic
1027536643 7:79411451-79411473 CTGGTTTGGACAATGGTGGAAGG + Intronic
1028568960 7:92265282-92265304 ATATTTGAGACAAAGATGGAAGG + Intronic
1030269728 7:107658218-107658240 CTGTTTCACACAGAGGTGGGTGG - Intergenic
1031303295 7:120090965-120090987 CTGTTTAAATGAAAGGAGGAAGG - Intergenic
1033476087 7:141694502-141694524 CTTTGGAAGACAGAGGTGGAAGG - Intronic
1034460435 7:151195123-151195145 CTGGTTAAGGCAAAGGTTGGAGG + Intronic
1036963185 8:13268624-13268646 CTTTTGGAGACCAAGGTGGAAGG - Intronic
1038893676 8:31756349-31756371 CTGTTAAGGGCAAAGGAGGAAGG + Intronic
1040633057 8:49238763-49238785 CTGTTTCAGAGAAAGTTGCAGGG - Intergenic
1042116378 8:65436151-65436173 CTGTTTAAAAAAAAGGTGATTGG - Intergenic
1043241447 8:77940149-77940171 CTTTCTCAGACAAAGATGGAAGG - Intergenic
1043258389 8:78164017-78164039 TTGTTTAATACAAACTTGGAAGG + Intergenic
1043448146 8:80339610-80339632 CTTTGGAAGACAAAGGTGGGTGG - Intergenic
1044327699 8:90878187-90878209 TTGTTAAAGACAATGGTTGAAGG - Intronic
1044744225 8:95356590-95356612 GTGCTAAAGACAAAGGTGGTTGG + Intergenic
1044749535 8:95402662-95402684 GTTTTTAAGACACAGGTGGATGG - Intergenic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1046693320 8:117310521-117310543 CTGCTTTAGACAAAGTTAGAGGG - Intergenic
1048902509 8:139052446-139052468 CTATTTAACACAAAAGTGCAAGG + Intergenic
1049676675 8:143892352-143892374 CTGTTTAAGAGAAATCTGGATGG - Intergenic
1050176263 9:2872348-2872370 TTGTATAAGTCAAAGATGGATGG + Intergenic
1050822882 9:9904137-9904159 CTGTGTCAGACAAAGATGGGTGG + Intronic
1051518319 9:17955604-17955626 CTGGGTAGGACAAAGGAGGAAGG - Intergenic
1051851461 9:21514098-21514120 CTTTTGAAGGCCAAGGTGGAAGG + Intergenic
1054969029 9:71062881-71062903 AGTTTTAAGTCAAAGGTGGAGGG - Intronic
1055304816 9:74918462-74918484 CTTTTTGAGACCAAGGTGGGTGG + Intergenic
1056597596 9:88020475-88020497 CTGCTTAAGAGAAAGGGAGATGG - Intergenic
1058805193 9:108583645-108583667 CTATTTAAAATAAAGGTGAAAGG - Intergenic
1059610485 9:115887277-115887299 CTGTTCAAGGCATAGGTGGAGGG + Intergenic
1059615462 9:115946095-115946117 ATGTTTAAAACTAAGTTGGAAGG + Intergenic
1185824126 X:3233362-3233384 GTGTTTATGAAAAAGTTGGAAGG - Intergenic
1186116512 X:6309831-6309853 CTGACTAATACAAATGTGGAAGG + Intergenic
1187483313 X:19678136-19678158 CTGATGAAGGCAAAGTTGGAAGG - Intronic
1187664941 X:21596515-21596537 TTGTTTTAGAGAAAGGTAGATGG - Intronic
1188043850 X:25402896-25402918 CTGTTCAAGCCCAAGGTGTAGGG + Intergenic
1190187028 X:48244147-48244169 CTGTTGAAGAGAAATGTGCATGG + Intronic
1192220006 X:69191453-69191475 CTGTTTCTGACAAGGGTGAAAGG + Intergenic
1193086308 X:77450078-77450100 CTGATTAACTCAAATGTGGAGGG - Intronic
1193512982 X:82429075-82429097 CTGTTTAAAACAACGGAGGCTGG + Intergenic
1193820628 X:86160193-86160215 CTGATTAAGACTAGGGTGGCAGG + Intronic
1195135535 X:101903942-101903964 ATATTTAATACAAGGGTGGATGG + Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196935644 X:120727997-120728019 CTGGACAAGACACAGGTGGAAGG + Intergenic
1197990245 X:132309842-132309864 ATGTTTAAGACAAATGTGTTAGG - Intergenic
1201478292 Y:14408815-14408837 CTATTTAAGAAAGAGGTGGCCGG + Intergenic