ID: 982167447

View in Genome Browser
Species Human (GRCh38)
Location 4:152627578-152627600
Sequence GAGGCTTATCCCAGCTTGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982167443_982167447 0 Left 982167443 4:152627555-152627577 CCTGTTGTGCTGTGTTAGGACAT 0: 1
1: 0
2: 1
3: 5
4: 101
Right 982167447 4:152627578-152627600 GAGGCTTATCCCAGCTTGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 134
982167442_982167447 3 Left 982167442 4:152627552-152627574 CCTCCTGTTGTGCTGTGTTAGGA 0: 1
1: 0
2: 0
3: 13
4: 112
Right 982167447 4:152627578-152627600 GAGGCTTATCCCAGCTTGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982167447 Original CRISPR GAGGCTTATCCCAGCTTGGC GGG Exonic
900128992 1:1079739-1079761 GAGGCTCAGAGCAGCTTGGCTGG + Intergenic
900408148 1:2501419-2501441 GAGTCTGAGCCCATCTTGGCAGG + Intronic
903450707 1:23452045-23452067 GAGGCTTAGGCAAGCTAGGCAGG - Intronic
904196682 1:28790918-28790940 GAGACTTCTCTCAGGTTGGCTGG - Intergenic
905543263 1:38777137-38777159 GAGGATTATCCCAGCTTGTGGGG - Intergenic
905573727 1:39026666-39026688 GATCCTTATCCCAGCTTTCCAGG + Intronic
906242438 1:44250325-44250347 GAGTCTTATCGCAGCTAAGCGGG + Intronic
906747522 1:48232165-48232187 CAGGCTTAGCCCAGCCTGCCAGG + Intronic
916251595 1:162743457-162743479 GAGACTTCTCTCAGCTTGGAGGG - Intronic
917879725 1:179322505-179322527 GAGGCTTGTCCCAGCTATTCAGG - Intronic
919819662 1:201465224-201465246 GAGGCTTCTCCCAGGGTAGCAGG + Intergenic
920939341 1:210466602-210466624 AAGGCTTCTCCCATATTGGCTGG + Intronic
1064152074 10:12873647-12873669 TAGAAGTATCCCAGCTTGGCCGG + Intergenic
1066097126 10:32083238-32083260 GAGGGTCATTCCAGATTGGCAGG + Intergenic
1067558374 10:47287728-47287750 GAGTCTGGTCACAGCTTGGCTGG + Intergenic
1069384102 10:67868999-67869021 TAGGCTTATTCTATCTTGGCCGG - Intergenic
1069574400 10:69516586-69516608 GAGGATGATCCCCACTTGGCCGG + Intergenic
1075155716 10:119974479-119974501 GAGGCTTCTCCCAGCCTCCCAGG - Intergenic
1076252768 10:128996839-128996861 CAGGCTTATCCCCCCTAGGCTGG - Intergenic
1076473224 10:130734683-130734705 GTGGCTCATTCCAGCATGGCGGG + Intergenic
1077211883 11:1375014-1375036 GAGGCTCAGCCCAGCCTGGGTGG - Intergenic
1077728135 11:4697750-4697772 GAGACTTATTCCAGCCTGACTGG + Exonic
1078012398 11:7582732-7582754 GAGACTCATCTCAGTTTGGCTGG - Intronic
1078606972 11:12785419-12785441 GAGGTTGTTCCCAGTTTGGCTGG + Intronic
1081596316 11:44462047-44462069 GGGGCCCCTCCCAGCTTGGCTGG + Intergenic
1082663458 11:55944943-55944965 GAGTCTTAGCGCAGCTTAGCTGG + Intergenic
1084143456 11:67250142-67250164 GAGGCTCATCGCAGCTCCGCAGG - Exonic
1084974152 11:72787473-72787495 GAGGCTTGTCCCAGGTGGGCAGG + Intronic
1085511209 11:77089056-77089078 TAGGCTTAGCAAAGCTTGGCAGG - Intronic
1091241250 11:134053854-134053876 AAGGCTTCCCCCAGCCTGGCAGG + Intergenic
1093718709 12:22413417-22413439 GAGGCTTGTTCGAGCTTGGTAGG + Intronic
1093892427 12:24538236-24538258 CATGCTAATCCCAGCTTGGGTGG + Intergenic
1094143110 12:27200968-27200990 GAGACTAATCCCAGCTGGGGTGG + Intergenic
1094590695 12:31817064-31817086 CGGGCTAATCCCAGCTTGGGAGG + Intergenic
1098204136 12:68089029-68089051 AAGGAATATCCCAGTTTGGCTGG - Intergenic
1109777653 13:67063255-67063277 GAGGTTTATCCCTGCTGGGCTGG - Intronic
1114368101 14:22052368-22052390 GAGACTTGTCTCAGATTGGCTGG + Intergenic
1118716918 14:68566638-68566660 GGGGTTTCTCCCAGCTTGGTAGG - Intronic
1120634643 14:86936694-86936716 GAAGCATATCCCAACTTGTCCGG + Intergenic
1122976981 14:105174749-105174771 GAGGCGTTGCCCAGCCTGGCTGG - Intronic
1124801273 15:32835176-32835198 GACACGTATCCCAGCTAGGCTGG - Intronic
1124887234 15:33698525-33698547 GACATTTATCCCAGCTGGGCTGG + Intronic
1128887985 15:71305802-71305824 GAGGCCTGTCCCAGCAGGGCAGG - Intronic
1132757824 16:1494485-1494507 CAGGCTGAGCCCAGCCTGGCTGG + Exonic
1136870466 16:33802947-33802969 GAGGCTTGGCCCAGCCTGGGGGG + Intergenic
1137547008 16:49411413-49411435 GAAGCTGATCCCAGCTGGCCTGG - Intergenic
1137757990 16:50917969-50917991 GAGGCCCTTCCCAGCCTGGCTGG + Intergenic
1139305422 16:65981633-65981655 CATTCTTATCCCAGCTGGGCTGG - Intergenic
1203101706 16_KI270728v1_random:1313103-1313125 GAGGCTTGGCCCAGCCTGGGGGG - Intergenic
1143345410 17:6245399-6245421 GAGGCTCCTGCCAGCTTGACTGG - Intergenic
1147661259 17:42118240-42118262 GAGGCTTAGCTCAGCCAGGCAGG + Intronic
1148648171 17:49230915-49230937 GAGCCTAATCCCACCTTAGCTGG - Intergenic
1152088485 17:78234231-78234253 CAGGCAGCTCCCAGCTTGGCTGG + Intronic
1152556867 17:81057751-81057773 GAGTATTCTCCCAGCTTGTCTGG + Intronic
1153368249 18:4284230-4284252 AAGGCTTCTCCCTGCTTGGAGGG - Intronic
1156425520 18:37007760-37007782 TGGGCTTATCCCATGTTGGCAGG - Intronic
1161171544 19:2814706-2814728 GAGGGTTATGCCAGCGAGGCGGG + Exonic
1161337895 19:3724111-3724133 CAGGCTTGTCCCAGCTTGTGCGG - Intronic
1165073951 19:33270472-33270494 GGGGCTCATCCCAGCAGGGCTGG - Intergenic
925975354 2:9138373-9138395 GAAGCATATCCCAGCAGGGCAGG - Intergenic
927707560 2:25306232-25306254 GAGGCTGATCCCAGCGTGAGGGG + Intronic
935400547 2:102655913-102655935 GAGGCTTCTCACAGCCTTGCTGG - Intronic
935852767 2:107241040-107241062 GGGGCTTATCACAGTTTGGGGGG + Intergenic
936068461 2:109349628-109349650 TAGGCTTCTCCAGGCTTGGCGGG + Intronic
937273213 2:120668419-120668441 GAGGCTGATCAAGGCTTGGCAGG - Intergenic
937979735 2:127607896-127607918 GGGGCCTTTCCCAGCTTGTCTGG - Intronic
939161086 2:138589693-138589715 GAGTCACATCCCAGCTGGGCTGG + Intergenic
940122583 2:150283223-150283245 GAGTATTATCCCAGCTGGTCAGG - Intergenic
941953787 2:171183992-171184014 GAAGATTATCCCAGATTGTCTGG + Intronic
946579627 2:221113903-221113925 AATGCTTATCCCAGTTTGTCTGG + Intergenic
948131077 2:235601030-235601052 GTGGCGTTTCCCAGCTTGGCTGG - Intronic
948659793 2:239499874-239499896 GAGCCTCTTCCCAGCTTGGGTGG + Intergenic
1168838297 20:892451-892473 CAGGCTTATGCCACCATGGCTGG - Intronic
1169073560 20:2748713-2748735 GAGGCCTTTCCCAGGGTGGCAGG - Intronic
1169498986 20:6141245-6141267 AAGGCTTCTCACAGCCTGGCTGG + Intergenic
1170800644 20:19587334-19587356 GCGGTTCATCCCAGCTTGGTTGG + Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1182416444 22:30224304-30224326 GAGGCGCATCCCAGCTTTACAGG + Intergenic
1185041853 22:48508228-48508250 CAGCTTTATCCCAGCTTTGCAGG + Intronic
1185087508 22:48748838-48748860 GAGGCCTAACCCAGGTGGGCAGG + Intronic
1185114035 22:48920999-48921021 GTGTCTCATCCCAGATTGGCTGG + Intergenic
949340118 3:3020521-3020543 TAGGCTTTTTCCAGCCTGGCTGG + Intronic
950136408 3:10584225-10584247 GAGGCAGAGGCCAGCTTGGCAGG + Intronic
950724185 3:14905910-14905932 GAGGCTTACCCCACCTTGAGGGG - Intronic
953563652 3:44013456-44013478 GAGGCTCATCCCTGCGGGGCTGG + Intergenic
953970267 3:47341941-47341963 GAGGCTTATGCCACCATGCCTGG - Intronic
956641308 3:71418274-71418296 GAGCCTTGTGCCAGCTTGGAGGG - Intronic
956684003 3:71807485-71807507 GAGGCTTATTTCAGCCTGGGAGG - Intergenic
960544252 3:118894590-118894612 TGGGCCTATCCCATCTTGGCTGG - Intergenic
963365309 3:144326283-144326305 GAGGCTGATCCCAGCTACTCAGG + Intergenic
964587019 3:158317699-158317721 GAGGCATATGCCACCATGGCTGG + Intronic
965589737 3:170351223-170351245 GAGTCTAGTCTCAGCTTGGCTGG - Intergenic
966068073 3:175840578-175840600 GACACTTATCCCAGCATGGAGGG + Intergenic
966196996 3:177323747-177323769 GAGGCTTCAGCCAGCTGGGCAGG - Intergenic
968646760 4:1744903-1744925 GGGGCTTCTCCCTGCTTGGAGGG - Intronic
982167447 4:152627578-152627600 GAGGCTTATCCCAGCTTGGCGGG + Exonic
983505012 4:168543694-168543716 GTATCTTTTCCCAGCTTGGCTGG - Intronic
986056874 5:4146803-4146825 GTGGCTTCTCCCAGCTTCACAGG - Intergenic
986830148 5:11568090-11568112 ATGGGTTCTCCCAGCTTGGCTGG + Intronic
988404844 5:30810946-30810968 GAGTATTTTCCCAGATTGGCTGG + Intergenic
989534690 5:42550221-42550243 GGTGCTGCTCCCAGCTTGGCCGG + Intronic
996817676 5:127591769-127591791 CAGGCTTGTACCAGCTTTGCAGG - Intergenic
1001014286 5:168126606-168126628 GAGGCTTGTCTCTCCTTGGCTGG - Intronic
1001565988 5:172699817-172699839 GCAGCTTATTCCAGCTTGGGTGG + Intergenic
1004667253 6:17759937-17759959 GTGGCTCAGCCCAGCTGGGCAGG - Intronic
1010785373 6:79994027-79994049 GAGGCTGAAGCCAGCATGGCTGG - Intergenic
1013396297 6:109744269-109744291 GAGGCTAATACCACCTTGTCTGG - Intronic
1018893530 6:167998336-167998358 GAGGCTGATCCCAGCTTCTGTGG + Intronic
1019363212 7:616510-616532 GGGGCTCATCCAAGCTAGGCAGG + Intronic
1019531900 7:1507522-1507544 GAGACTTACCCCAGCGTTGCAGG + Intergenic
1021660202 7:22912526-22912548 TGGGGTTATCCCAGCTTGGCCGG - Intergenic
1021987618 7:26112295-26112317 GGAGCTTATCCCAGCTGAGCTGG - Intergenic
1022624931 7:32025494-32025516 GAAGCTGATCCCAGCAAGGCTGG + Intronic
1025608415 7:63055968-63055990 GAGGCTGATCCCAGCTACTCAGG - Intergenic
1030909067 7:115224198-115224220 AAGGCTTATTCCAGCCTGGCTGG - Intergenic
1034418012 7:150975230-150975252 GAGGCTGAGGCCAGCCTGGCGGG + Intronic
1035823376 8:2618645-2618667 GTGGCTTGTCCCAGCTTGTTTGG - Intergenic
1037501699 8:19492544-19492566 GAGGCTTGGCCCAGGTTGGCAGG - Intronic
1038977520 8:32716653-32716675 GGGCCTTATCTCAGCTTGCCTGG - Intronic
1042905440 8:73767431-73767453 GAAGCTTATCCCAGATTATCTGG + Intronic
1043319709 8:78968739-78968761 TAGGCTTATGTAAGCTTGGCGGG + Intergenic
1048203925 8:132400687-132400709 GAGGCTTATCCCAGTGGGGAGGG + Intronic
1049212722 8:141394170-141394192 GAGGCCTCTCCCTGGTTGGCAGG + Intronic
1049299813 8:141863520-141863542 GAAGCTTCTCACAGCCTGGCAGG + Intergenic
1049467449 8:142758235-142758257 GAGGCTCATGCCAGCATGCCCGG + Intergenic
1050690853 9:8224694-8224716 GAGTCTTTTCACAGGTTGGCAGG - Intergenic
1051736174 9:20201291-20201313 GAGGCTTCAACCAGCTTGCCAGG + Intergenic
1052704866 9:31982278-31982300 CAAGCTGATCCCAGCTGGGCAGG + Intergenic
1053210743 9:36225490-36225512 CAGGCTTATGCCAGCATGCCTGG - Intronic
1057566662 9:96171037-96171059 GAGGCTTCTCCAAGGTAGGCTGG - Intergenic
1057803464 9:98204036-98204058 GAGCCTTATGCTAACTTGGCGGG - Intronic
1058879953 9:109277612-109277634 GTGGCTTGTCCCAGCCTGCCAGG - Intronic
1059452191 9:114377346-114377368 GAGGCTGGTCTCAGCTTGGAAGG - Exonic
1061027475 9:128059450-128059472 AAGGAGTATCCCTGCTTGGCAGG + Intergenic
1061517816 9:131099603-131099625 GGGGCACAGCCCAGCTTGGCTGG + Intronic
1186496150 X:10014593-10014615 GGGGCTTTTCCCACCTTCGCGGG + Intergenic
1189740329 X:44111160-44111182 TAGGCTTACTCCATCTTGGCTGG + Intergenic
1190932105 X:54957626-54957648 GAGGCAGATTCCAGCTTGACTGG + Intronic
1192506556 X:71688748-71688770 GAGGCTTATCCCAGGAATGCAGG - Intergenic
1192520141 X:71792798-71792820 GAGGCTTATCCCAGGAATGCAGG + Intergenic
1193196810 X:78641870-78641892 GAGACTTATCCCAGGAAGGCAGG - Intergenic