ID: 982170248

View in Genome Browser
Species Human (GRCh38)
Location 4:152655234-152655256
Sequence GCATCCTTCTTGGCTGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982170248 Original CRISPR GCATCCTTCTTGGCTGAGAC TGG Intronic
904557161 1:31372841-31372863 GCATCCCTCCTGGTTAAGACTGG - Intronic
905830890 1:41066384-41066406 GCAGCCTACCTGGCTGAGATTGG - Intronic
907248567 1:53123143-53123165 GCAGCCTTCTTGGTGGAGAATGG - Intronic
908315095 1:62924657-62924679 GGATCCTGCTCAGCTGAGACGGG - Intergenic
908755610 1:67466543-67466565 TCATTCTTCTTGGCTGGGAATGG + Intergenic
910527255 1:88195029-88195051 GTATCTTTCTTGGTTGTGACAGG - Intergenic
912495029 1:110086011-110086033 GCAGCCTTCTGGGCTGGGGCAGG + Intergenic
919289992 1:195617402-195617424 GCATCCTTCCTGAAGGAGACAGG - Intergenic
920384357 1:205558178-205558200 GCAACTTTGTAGGCTGAGACAGG + Intergenic
1063100205 10:2943858-2943880 GCATCCTTCCTGGCAGAGAGGGG + Intergenic
1065741699 10:28802786-28802808 GAAACCTTAATGGCTGAGACAGG - Intergenic
1070510975 10:77160260-77160282 GCATCCTTCTTTGGGGAGCCAGG - Intronic
1070643459 10:78185406-78185428 ACATCTTTCTTGGCTCAGAGAGG - Intergenic
1070956310 10:80465717-80465739 GCATCCTTTGTGCCTGAGAGTGG - Intronic
1075319082 10:121475332-121475354 TCTTCCCTCTTGGCTGAGAGAGG - Intergenic
1075636311 10:124033163-124033185 TCATCCTTTCTGGCTGAGATGGG + Intronic
1076334079 10:129693432-129693454 GAACCCTTCTTAGCTTAGACCGG - Intronic
1078438837 11:11347469-11347491 GCATACTTCTCCACTGAGACTGG - Intronic
1079676177 11:23229743-23229765 GCATCCTTCATAGCTGTGGCTGG - Intergenic
1080581940 11:33651491-33651513 GCCTCCTTCTTCCCTGGGACAGG + Intronic
1081637806 11:44732317-44732339 CCATCCTTGTAGGCGGAGACAGG - Intronic
1081887917 11:46515181-46515203 ACATCCTTCTTGGCTGGGCGTGG + Intronic
1084167478 11:67382579-67382601 GCATCCTCCCAGGCTGAGACAGG - Intronic
1084503984 11:69553785-69553807 GCACCCTTTTTGGCCAAGACAGG - Intergenic
1085179079 11:74518452-74518474 GTATCTTTCTTTTCTGAGACAGG + Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085450564 11:76629742-76629764 GCACCCTTCTTGCCTGCGAAGGG - Intergenic
1085469400 11:76747625-76747647 GCAGCTTTCTTGGCTGCTACAGG + Intergenic
1085812797 11:79700604-79700626 GCATGCTTGTTGGCTGTGACAGG - Intergenic
1087353144 11:97059669-97059691 GCAGCCTGCTTGGCTGAAATTGG + Intergenic
1087551531 11:99656664-99656686 GCAGGCATCTTTGCTGAGACTGG - Intronic
1092382931 12:8012584-8012606 GCTTCCTTCTTGGTTGGTACAGG + Intergenic
1092729272 12:11513005-11513027 ACACCCTTCTTCACTGAGACTGG - Intergenic
1093695821 12:22159197-22159219 GCTTCCTTCTTTTCTGAGAAAGG + Intronic
1096079328 12:48823295-48823317 GCATCCTTCATGCCGGAGCCTGG + Intronic
1096849745 12:54428003-54428025 GCAGCCTTCATGGCAGAGGCCGG - Intergenic
1097673879 12:62575118-62575140 TCATCTTTCTTTGTTGAGACAGG - Intronic
1103702328 12:122854422-122854444 GCCTCCGTCTTGGCCGAGCCAGG - Intronic
1104719695 12:131038492-131038514 GCATCTTTCTTCTCTGTGACTGG + Intronic
1113309868 13:109121192-109121214 ACATCCTTCTTGGCTGTTCCAGG + Intronic
1118019316 14:61695287-61695309 GCCTCCTGATTGGCTGAGAGCGG + Intergenic
1118752627 14:68817754-68817776 GCATTCTTCTTGGCACTGACGGG - Intergenic
1120116022 14:80618685-80618707 GCATCCATTTTGAATGAGACAGG + Intronic
1120719416 14:87874314-87874336 ACAGCCTACATGGCTGAGACAGG + Intronic
1125346902 15:38727678-38727700 GCATCCTTCATGGATCAGAATGG - Intergenic
1125436472 15:39650568-39650590 GGATCTTTGATGGCTGAGACAGG + Intronic
1126166012 15:45654520-45654542 GTAGCCTTCTTGGCTGAGTGAGG + Intronic
1126197357 15:45947240-45947262 GCAGCCATCTTTGCTGGGACAGG - Intergenic
1128308514 15:66615834-66615856 GCATTCTGCCTGGCTGAGCCTGG + Intronic
1128672113 15:69581449-69581471 GCATGCTTCTGGGGTGTGACAGG + Intergenic
1129564986 15:76612198-76612220 GCAGCTTTTTGGGCTGAGACTGG - Intronic
1131443154 15:92473960-92473982 GCATCCTTCTTTGCACATACCGG + Intronic
1136376394 16:29867984-29868006 GTATCCTTGCTGGCTGAGGCTGG - Intergenic
1142099341 16:88263397-88263419 GCAGCCTTCTGGGCAGACACAGG - Intergenic
1144550906 17:16240186-16240208 GCATCCTACATGGCAGAGGCAGG - Intronic
1144803650 17:17949378-17949400 GCCTCCTTGGGGGCTGAGACAGG - Intronic
1146094097 17:29911528-29911550 GCAACTTGCTTGGCAGAGACAGG + Intronic
1147919648 17:43907857-43907879 CCACCCATCTTGGCTTAGACCGG + Intronic
1148229787 17:45924656-45924678 GCAGCCTTATTGACTGAGATGGG - Intronic
1151135026 17:71938284-71938306 GCATACTTTTTGTCTGTGACAGG + Intergenic
1152555856 17:81052803-81052825 GCCTCCTGCTTGTCTGCGACAGG + Intronic
1155640852 18:28012489-28012511 GCATCCATCATGGCTGACATAGG - Intronic
1157579868 18:48767400-48767422 GAATGCTCCTTTGCTGAGACAGG + Intronic
1159148388 18:64484969-64484991 GCTTCCTTCCTGGCTGTTACAGG + Intergenic
1165933050 19:39372748-39372770 GCCTACTTCTTGGCTGAGAAGGG + Intronic
926386798 2:12343207-12343229 GCTTCCTTCCTGGCTGGGCCAGG + Intergenic
930037673 2:47097532-47097554 GCATCCTTCCTGTCTGAGGAAGG - Intronic
931035900 2:58242500-58242522 CCATCCTTCTTCCCTGAGGCGGG + Intergenic
931276097 2:60745202-60745224 GCACCCTTCTTGCCTGAGAATGG - Intergenic
933581247 2:84129423-84129445 GAATTCTGTTTGGCTGAGACAGG - Intergenic
935449319 2:103190617-103190639 GCATGCTTCTTGGCTGCGGCAGG - Intergenic
936019753 2:108985833-108985855 TCATCCTTCTTGTCAGAGAAAGG - Intronic
937009786 2:118552196-118552218 GCATCAGGCTGGGCTGAGACAGG + Intergenic
938279054 2:130051832-130051854 GCATCCCTGCTGGCTGACACTGG + Intergenic
938330038 2:130442708-130442730 GCATCCCTGCTGGCTGACACTGG + Intergenic
938359907 2:130678795-130678817 GCATCCCTGCTGGCTGACACTGG - Intergenic
938436316 2:131285516-131285538 GCATCCCTGCTGGCTGACACTGG - Intronic
942405314 2:175647361-175647383 GCATGCTTATTGGCTGTGGCAGG - Intergenic
942882718 2:180882650-180882672 AAATCCTTCTTGGCTGGGATTGG + Intergenic
946015220 2:216598893-216598915 CCATCCCCCATGGCTGAGACAGG + Intergenic
946830649 2:223725063-223725085 ACATCCTTCCAGCCTGAGACAGG - Intergenic
948687479 2:239677989-239678011 GCACCCTTCTGACCTGAGACGGG + Intergenic
1168976900 20:1973603-1973625 GCATTTTTCAAGGCTGAGACGGG + Intergenic
1169479826 20:5969478-5969500 GCTTCCTGGGTGGCTGAGACAGG + Intronic
1171519512 20:25765189-25765211 GCATTCTCCAAGGCTGAGACTGG + Intronic
1171557408 20:26091304-26091326 GCATTCTCCAAGGCTGAGACTGG - Intergenic
1173021133 20:39269038-39269060 GCTCCTTTCTTGGCTGAGGCTGG + Intergenic
1173378027 20:42507419-42507441 GAAGCCTTCTTGGCCGAGAAGGG + Intronic
1173746511 20:45441534-45441556 GGAATCTCCTTGGCTGAGACAGG + Intergenic
1173950240 20:46987081-46987103 GCATCCTGCTTAACTGATACAGG + Intronic
1175125778 20:56750618-56750640 GCACCCTGATTGGCTTAGACAGG + Intergenic
1177349886 21:19923772-19923794 GCAACATTCTTGCCTGAGAGAGG + Intergenic
1178263059 21:31117535-31117557 GCATTTTTCTTTTCTGAGACAGG + Intergenic
1179265211 21:39796995-39797017 GCATCCTCCTCTGCTGAAACTGG + Intronic
1181144306 22:20833386-20833408 GCATGCTCATTGGCTGAGGCAGG + Intronic
1181269702 22:21652079-21652101 GCATGCCTGTTGGCTGAGACGGG - Intergenic
1182035200 22:27192840-27192862 GCAGCCCTCTTGGCTGAGACTGG + Intergenic
1182129310 22:27839301-27839323 GCATCCTGCCGGGCTGGGACAGG - Intergenic
1182412026 22:30195420-30195442 GAATCCTTCTTATCTGAGAGAGG - Intergenic
949743511 3:7263441-7263463 GCACCCTCATTGGCTGTGACAGG + Intronic
953104323 3:39860976-39860998 GCATGCTTGTTGGCTGAGACAGG - Intronic
954202874 3:49035147-49035169 GAATCCTTCTTTGCTGAGAAGGG - Intronic
967824485 3:193867689-193867711 GCATCATTATTGGCTGAAAAAGG - Intergenic
972342200 4:38162311-38162333 GCAGACTTCCTGGGTGAGACAGG - Intergenic
973232706 4:47860711-47860733 ATATACTTCTTGGCTGACACTGG + Intronic
974650410 4:64747962-64747984 GCATGCTTATTGGCTGTGTCAGG + Intergenic
982170248 4:152655234-152655256 GCATCCTTCTTGGCTGAGACTGG + Intronic
982859877 4:160435088-160435110 CCATCCTGCCTGGCTGACACTGG + Intergenic
983506220 4:168556525-168556547 GCATCCTGCTTCGCTGGTACAGG - Intronic
985302177 4:188502164-188502186 TAATCCTTCTTGGCTAAGAATGG - Intergenic
993178441 5:84518512-84518534 GCATGCTTATTGGCTGTGCCAGG + Intergenic
994643018 5:102433775-102433797 GCATGCTTTTTGGCTGTGGCAGG + Intronic
994961058 5:106603371-106603393 GCCTCCCTATTGCCTGAGACAGG + Intergenic
996472435 5:123876340-123876362 TCACCCTTCTTGGCGCAGACTGG + Intergenic
996807671 5:127475724-127475746 CCATCCCTCTTAGGTGAGACAGG + Intergenic
996954162 5:129163819-129163841 GCATATTTGTTGGCTGTGACAGG + Intergenic
997283009 5:132660293-132660315 GCATCATTATTTGCAGAGACAGG + Exonic
997671735 5:135680054-135680076 GCAGCCTGCTTGGCTGGGATTGG - Intergenic
997674539 5:135702882-135702904 GCCTCCTTCGTGGCTCACACAGG + Intergenic
1000760035 5:165211752-165211774 GAATCCTTCTTGGAGAAGACAGG - Intergenic
1003321327 6:5054618-5054640 GAATCCTTCTTGGCCAAGAGAGG - Intergenic
1006952671 6:37837202-37837224 ACAGACTTCTTGGCTGATACTGG + Intronic
1007089028 6:39170374-39170396 AGAGCCTTCCTGGCTGAGACTGG + Intergenic
1007378629 6:41472536-41472558 GCTTCCTTCTCTGCAGAGACAGG + Intergenic
1012864178 6:104597640-104597662 GCATCCTGCCTGGCTGATCCAGG - Intergenic
1013309118 6:108877070-108877092 GCATCATTACTGGCTGGGACTGG - Intronic
1016453569 6:144209197-144209219 GCATGCTTCTTGGCTGCAGCAGG + Intergenic
1019898264 7:3999864-3999886 GCATCATTCCTGGCTGAAAAGGG + Intronic
1022284264 7:28940101-28940123 ACACCTTTCTTTGCTGAGACTGG - Intergenic
1022307778 7:29164667-29164689 GCATCCCTGGTGGCTGAGGCAGG + Intronic
1022652521 7:32290199-32290221 GCACCCGGCTTGGCTGAGACAGG + Intronic
1026244755 7:68609875-68609897 GCTTCCTTCTGTGCTAAGACTGG - Intergenic
1027816522 7:82979730-82979752 CCATCCTTACTGGCTAAGACTGG - Intronic
1028204624 7:88002374-88002396 GCATGGCCCTTGGCTGAGACTGG + Intronic
1031684029 7:124709852-124709874 GCAGCCAGCTTGGCTGAGATTGG - Intergenic
1032734735 7:134681448-134681470 GCATCCTTCTATTCTGAGGCTGG + Intergenic
1035203344 7:157279994-157280016 GCTTCCAGCTTGGCTGAGAAAGG + Intergenic
1038067729 8:23980619-23980641 GCATCTTTCTTCGCAGACACTGG - Intergenic
1041476594 8:58274050-58274072 AGATCCTTCTTGGCAGAGCCAGG + Intergenic
1041635075 8:60133675-60133697 GCATTCTTCTTTGATGAGCCTGG - Intergenic
1041830409 8:62147247-62147269 GCAGCCTGCTTGGCTGGGATTGG + Intergenic
1042937400 8:74073782-74073804 GCCTCCTGCCTGGCTGAGGCAGG + Intergenic
1043113063 8:76212735-76212757 GCAGTCTTCTTGCCTGAGACTGG - Intergenic
1043376123 8:79651813-79651835 GCATCCTGCTTTGCTGAGCCTGG - Intronic
1044017903 8:87068811-87068833 ACTTCCCTCTTGGCTGAGAGAGG - Intronic
1049908950 9:246507-246529 GCCTCCTTTTTTCCTGAGACAGG - Intronic
1053474096 9:38369651-38369673 GAATCCTTCTTGGCTGAATAGGG - Intergenic
1056467083 9:86868240-86868262 GTCTCCTTCTTGGCTGAGGAAGG - Intergenic
1060938379 9:127528907-127528929 GCCTCCTGCTGGGCTGGGACTGG - Intronic
1061297945 9:129687089-129687111 TCCTCCTACTTGGCTGAGGCAGG + Intronic
1186442271 X:9596565-9596587 GCATCATTCTTGGCTGTGGTGGG - Intronic
1186874421 X:13803171-13803193 GCCCCCTTCTAGGCTGAGCCTGG - Intronic
1191693224 X:63962122-63962144 GCATGCTTCTTGGCCTAGGCAGG + Intergenic
1191743039 X:64455998-64456020 AGGTCCTTCTTGGCTGAGAGAGG - Intergenic
1192640813 X:72860046-72860068 GCAGCCTTCATGTCTGACACAGG + Intergenic
1192640898 X:72860730-72860752 GCAGCCTTCATGTCTGACACAGG - Intergenic
1194283613 X:91983183-91983205 TCATCCTTCTTACCTAAGACTGG - Intronic
1195410860 X:104566831-104566853 GTATCCTCTTTGGCTAAGACAGG + Exonic
1195548477 X:106139279-106139301 GCATGCTTGTTGGCTGTGGCAGG - Intergenic
1196016564 X:110945526-110945548 GGATCCTCATTGGCTGAGAGAGG - Intronic
1197034240 X:121854661-121854683 CCATGCTTCTTGGCTGCGACAGG - Intergenic
1197566527 X:128094667-128094689 GCATCCATCTTGGCTGATACTGG - Intergenic
1200601186 Y:5207747-5207769 TCATCCTTCTTACCTAAGACTGG - Intronic
1201390355 Y:13490570-13490592 GCAGCCTGCTTGGCTGGGATTGG - Intergenic