ID: 982170250

View in Genome Browser
Species Human (GRCh38)
Location 4:152655238-152655260
Sequence CCTTCTTGGCTGAGACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982170250 Original CRISPR CCTTCTTGGCTGAGACTGGC TGG Intronic
900395082 1:2450164-2450186 CCTTCTTGGCTGGGCCTCGACGG + Intronic
900793199 1:4692699-4692721 TCTGCTTGGCTGAGCCTGGAAGG - Intronic
901372978 1:8816848-8816870 CATTATTGGCTGAAACTGGAAGG - Intronic
902636346 1:17737251-17737273 CCTCCTTGGCTGACTCTAGCTGG + Intergenic
902709604 1:18229782-18229804 ACTGCTTGGCTGACACAGGCTGG + Intronic
903018040 1:20374487-20374509 CCTTCTTGGGGGTGACTGCCAGG + Intergenic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
905168057 1:36094751-36094773 CTTTCGTGGCTGAGCATGGCAGG + Intergenic
906513501 1:46424593-46424615 CTGGCTGGGCTGAGACTGGCAGG + Intergenic
910612726 1:89162653-89162675 GCTTTTGGGCTGAGACTGGGGGG + Intronic
914339624 1:146748927-146748949 CCTTCCTGGCTGGGAGGGGCAGG + Intergenic
917687382 1:177431177-177431199 CTCTCTTGGCTGACACTGTCTGG + Intergenic
918589131 1:186221448-186221470 CCTCCTTGCCTAAGCCTGGCTGG + Intergenic
918736664 1:188072300-188072322 CCTGCTTGACTGAGATTGGCTGG - Intergenic
918970772 1:191415426-191415448 CCTTCTTGGCTAGTGCTGGCTGG + Intergenic
920515151 1:206579840-206579862 CCCTCGTGGCTGTGGCTGGCTGG + Intronic
920602895 1:207346994-207347016 CCTGTTTGGCTGAGATTGCCTGG - Intronic
921471749 1:215557707-215557729 CCTGCTTAGCTGGGATTGGCTGG - Intergenic
921620971 1:217325865-217325887 CCTTCTGGGCTAAGGCTGACTGG - Intergenic
1064705299 10:18066817-18066839 CCTTCTTAGGTGAGGCTGGATGG + Intergenic
1070689581 10:78514667-78514689 CCTGCATGGCTGAGCCTGCCTGG - Intergenic
1071954935 10:90747753-90747775 CGTTCTTCACTGAGCCTGGCAGG - Intronic
1073254242 10:102140899-102140921 TCTTCTTGGCTGGGGCTGGTGGG - Exonic
1075319080 10:121475328-121475350 CCCTCTTGGCTGAGAGAGGAAGG - Intergenic
1078246865 11:9581430-9581452 CTTTCTTGGTTGAGATTGGTTGG + Intronic
1078780957 11:14439015-14439037 CCTCTTTCTCTGAGACTGGCAGG + Intergenic
1080622619 11:33999278-33999300 CATTCTTGGCTGGCACTGGAAGG - Intergenic
1081447365 11:43143877-43143899 CCTTCTTGGGTGGGACTGCCTGG + Intergenic
1083051829 11:59784110-59784132 GTTTCTAGGATGAGACTGGCAGG - Intronic
1084199815 11:67548918-67548940 CCAGCTTGGCTGAGTCTCGCTGG + Intergenic
1084266601 11:68008375-68008397 CCATCTTGGCGGGTACTGGCAGG - Intergenic
1085473314 11:76771937-76771959 CCCTCAGGGCTGAGACTGGAGGG - Intergenic
1086230547 11:84564454-84564476 CCTTATTGGGTGAGACTGCAAGG + Intronic
1087353146 11:97059673-97059695 CCTGCTTGGCTGAAATTGGCTGG + Intergenic
1089701245 11:120245385-120245407 CCTGCTTGACTGGGATTGGCTGG + Intronic
1090064955 11:123494787-123494809 CCTTCTTCGCTGAGGCTGGTAGG - Intergenic
1093512879 12:19949613-19949635 GCATTTTGGCAGAGACTGGCAGG - Intergenic
1093904822 12:24677994-24678016 CCTTCTTGCCAGAAACTAGCTGG + Intergenic
1094406334 12:30120382-30120404 CCTTCTTGGCTAGAGCTGGCTGG - Intergenic
1095934014 12:47657323-47657345 CCTTCATGCCTGAGACTAGATGG + Intergenic
1097196136 12:57243336-57243358 CCATCTGGGCTGAGGTTGGCGGG - Intergenic
1097880016 12:64678402-64678424 CCTTCTCTGCTGACACAGGCTGG + Intronic
1098403098 12:70094551-70094573 CCTTAGTGGCAGAGACTGGTAGG - Intergenic
1104846294 12:131848757-131848779 CCTTCCTGGCTGAGGCTGAGCGG + Intronic
1105645941 13:22317407-22317429 CCTTCTTGGTGGACAATGGCAGG + Intergenic
1105867555 13:24474358-24474380 CCTTCAGGGCTGAGACTGCTAGG + Intronic
1115582373 14:34774071-34774093 CCTTCTCTGCTGAGTCTGGTTGG - Intronic
1118191151 14:63581522-63581544 GCTTGTTGACTGAGACTGGGAGG + Intergenic
1119609321 14:76048336-76048358 CCCCCTTAGCAGAGACTGGCTGG - Intronic
1122064314 14:99161128-99161150 CCTTTTTTGCTGAGACTGCTAGG - Intergenic
1122248119 14:100418684-100418706 CCGTTGTGGCTGAGACTGGCAGG - Intronic
1122257012 14:100485762-100485784 CCTTCTTGCTTCAGACTGGCTGG + Intronic
1122580574 14:102769148-102769170 CCCTCTTGGCTCTGACTGGAAGG + Intergenic
1122881340 14:104691803-104691825 CCTCCTAGGGTGAGGCTGGCAGG - Intronic
1130210193 15:81915238-81915260 GCTTCTAGCCTGACACTGGCTGG - Intergenic
1130322275 15:82851107-82851129 CCTTCTTGTCTGAGCCAGGATGG + Intronic
1131289596 15:91095159-91095181 CGTTCTTGGTTGAGAGTGGAGGG - Intergenic
1131302794 15:91214251-91214273 CCTTCTTGGGTGAGACCCTCTGG - Intronic
1133106474 16:3513364-3513386 ACTTCTTGGCTGGCATTGGCTGG - Intronic
1136363869 16:29799501-29799523 CCTTCTTCCCTGAGACAGGTGGG - Intronic
1136376391 16:29867980-29868002 CCTTGCTGGCTGAGGCTGGAGGG - Intergenic
1139892491 16:70262579-70262601 CCTTCTTGGCTGACTTTTGCTGG + Intronic
1139994662 16:70968481-70968503 CCTTCCTGGCTGGGAGGGGCAGG - Intronic
1140466985 16:75190436-75190458 CTGTCTTGGGTGTGACTGGCTGG - Intergenic
1143325194 17:6093987-6094009 CCTACTTGGCAGATTCTGGCTGG + Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1144275842 17:13667508-13667530 CCTGCTGGGTTGAGACTGACTGG + Intergenic
1146567991 17:33929654-33929676 CCTCCTTGGACAAGACTGGCAGG - Intronic
1146937882 17:36823937-36823959 CCTCTCTGGCTGAGGCTGGCAGG - Intergenic
1147598538 17:41732232-41732254 CCTCCTTGGCTGAGCCCAGCAGG + Exonic
1148853283 17:50565066-50565088 CCATCCTGGCTGAGGCAGGCAGG - Intronic
1148906425 17:50915239-50915261 CCTTCTGGGCTGGGCATGGCAGG + Intergenic
1149979363 17:61297393-61297415 CTTTATTGGCTTAGACTGTCTGG + Intronic
1151113638 17:71707539-71707561 CCTTCCTGGATGAGTCTAGCTGG - Intergenic
1151721867 17:75861489-75861511 CCCTCTTGGCAGAGCCTGGCAGG + Intergenic
1151892020 17:76956582-76956604 CCCTCTTAGCTGGGCCTGGCGGG + Intergenic
1152130048 17:78471016-78471038 ACTACTTGGATGAAACTGGCAGG - Intronic
1156227533 18:35123978-35124000 ACATCTGAGCTGAGACTGGCAGG + Intronic
1156509615 18:37625554-37625576 TCTTCGTGGCTGTCACTGGCTGG + Intergenic
1157375925 18:47165000-47165022 CGTTTTTGGCTGAGCCTGGATGG - Intronic
1160803040 19:979388-979410 CCATCCTGGCCGAGGCTGGCCGG + Intergenic
1161495431 19:4583657-4583679 CCTTCTTGGCTGTGCCCAGCTGG + Intergenic
1162458932 19:10802980-10803002 CCTTCCTGCCTGAGGCAGGCCGG + Intronic
1163345141 19:16736384-16736406 CATGCTTGGCTTTGACTGGCAGG + Intronic
1163397167 19:17070363-17070385 CCTTCAGGGCTGAGACAGGCTGG + Intronic
1164505936 19:28861201-28861223 CACTCTGGGCTGAGACTGGATGG - Intergenic
1164594029 19:29521901-29521923 CAGGCTTGGCAGAGACTGGCAGG + Intergenic
1166322679 19:42028392-42028414 CCCTATTGGCAGAGCCTGGCAGG - Intronic
1167773509 19:51538684-51538706 CCTCCCTGGCTGGGATTGGCTGG - Intergenic
1168241429 19:55091060-55091082 CCCACCTGGCTGAGGCTGGCGGG + Exonic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
926812621 2:16769830-16769852 TCTTCTTGGCTGGTGCTGGCTGG - Intergenic
927922314 2:26982499-26982521 CCTTCCTGGTAGGGACTGGCAGG - Intronic
928424939 2:31170155-31170177 CCTTTTGGGCTGAGTCTGGCTGG + Intergenic
929651194 2:43681363-43681385 ACTTCTTGGCTGCTACTGGAAGG + Intronic
929828612 2:45329680-45329702 CCTGCATGGCTGAGCCAGGCAGG + Intergenic
929945389 2:46367653-46367675 CCTTCTGCTCTGAGACTGGCTGG + Intronic
931215098 2:60234670-60234692 ACTTCCTGGCTAAGAGTGGCTGG + Intergenic
932466947 2:71930141-71930163 CCTTCTTGGCCAGGAGTGGCAGG - Intergenic
935713295 2:105917929-105917951 CCTTGCTGGGTGACACTGGCAGG + Intergenic
937157582 2:119731888-119731910 CCTTGTTGGCTGTCACTGGGGGG - Intergenic
937913752 2:127088960-127088982 CCGGCGTGGCTGAGAGTGGCAGG + Intronic
939949739 2:148455714-148455736 CCAACTTCCCTGAGACTGGCTGG - Intronic
940015243 2:149097567-149097589 CCTACCTGGCTGAGACTGTTAGG - Intronic
941118921 2:161506051-161506073 TCTTCTTGGCTTAAACTGGAAGG + Intronic
941978471 2:171431061-171431083 CCCTCTTGGCTGAGAATGAAAGG + Intronic
942882720 2:180882654-180882676 CCTTCTTGGCTGGGATTGGTTGG + Intergenic
947046329 2:225990953-225990975 CCATCATGGATGAGAGTGGCAGG + Intergenic
947485370 2:230543407-230543429 GCTTCTGGGCTGAGACTAGGGGG - Intronic
948265406 2:236632185-236632207 CCTGCTAGGCGGGGACTGGCAGG + Intergenic
948658610 2:239492385-239492407 CTCTCTTGGGTGAGCCTGGCTGG + Intergenic
948866121 2:240775724-240775746 CTTTCTGGGCTGAGGCTGGGAGG - Intronic
1168861629 20:1049819-1049841 CCTTCTAAGGTGAGACTGGAAGG - Intergenic
1173230953 20:41197153-41197175 TCATCTTGGCTGAGTCTTGCTGG + Intronic
1175895544 20:62334146-62334168 ACTTCTAGGCTGAGCCTGGGAGG + Intronic
1179180255 21:39038397-39038419 CCTTCTAGGCTGGGCATGGCAGG - Intergenic
1180043869 21:45293937-45293959 CCCTCCTGGGTGAGACTGGCCGG + Intergenic
1181170837 22:21008994-21009016 CCTTCTTGGCTGAGATGACCAGG + Intergenic
1182428277 22:30286205-30286227 CCTCCCTGCCTGGGACTGGCTGG + Intronic
1182714728 22:32348398-32348420 CCTTCTGTGCTGAGTCTGGTGGG + Intergenic
1183002652 22:34874589-34874611 CCTACTTGGCTGAGCCTGCCAGG + Intergenic
1183015601 22:34983946-34983968 CCGTCTTGGCCGAGACAGGCTGG + Intergenic
1183265806 22:36824339-36824361 CCTTCTTGGGTGGTACTGGAGGG + Intergenic
1184098224 22:42328149-42328171 CCTGCATGGCTGAGCCTGGGAGG - Intronic
1184592796 22:45496382-45496404 GCATCTTGGCTGAGACTTGAAGG + Intergenic
1185025721 22:48410711-48410733 CCTTCTTGTCTGACCCTGGCAGG - Intergenic
1185099404 22:48829737-48829759 CCTTGGTGACTGAGACTGGCAGG - Intronic
949806874 3:7964954-7964976 CTCTCTGGGCTGGGACTGGCTGG + Intergenic
950008463 3:9705687-9705709 CCTTCTTGGCTGCCACTGCTGGG + Intronic
950464540 3:13145553-13145575 CCCTCCTGCTTGAGACTGGCTGG - Intergenic
952146829 3:30542481-30542503 TCTTCTTGGATGAAGCTGGCTGG - Intergenic
952810769 3:37400594-37400616 CTGTTTTGGCTGAGGCTGGCTGG + Intronic
953019476 3:39104521-39104543 CCCTCTGGGCTGGGTCTGGCTGG - Intronic
953239046 3:41132122-41132144 CCTTTTTTGCTTAGACTGCCAGG - Intergenic
953912623 3:46900576-46900598 CCCTCGTGGATGAGACTGGATGG - Intronic
955015182 3:55063339-55063361 CCTTCAAGGCTGAGACTGTCTGG - Intronic
955166567 3:56520590-56520612 TCTTCTTGGCTGACAGAGGCAGG - Intergenic
955806565 3:62741874-62741896 ACTTCTGGGCTGAGACTGTGTGG - Intronic
957279275 3:78128641-78128663 CCTTCTTGTCTTAAACTTGCTGG + Intergenic
960013010 3:112853738-112853760 TCTTTTGGGCTGAGACTGGGGGG - Intergenic
960589406 3:119350960-119350982 GCTTCTTGGATGACACTGGGAGG - Intronic
962507079 3:136058268-136058290 GCTTTTGGGCTGAGACTGGGGGG - Intronic
964290299 3:155171006-155171028 CCATCTTGGCTGAAAGTGGAAGG + Intronic
968044859 3:195618294-195618316 CCTTCTTGGCTCACCCTGGAAGG + Intergenic
968060643 3:195724346-195724368 CCTTCTTGGCTCACCCTGGAAGG + Intronic
968290215 3:197533256-197533278 CCTTCCTGGCTGGGAGGGGCTGG + Intronic
969152867 4:5185404-5185426 GTTTCTTGGCTTAGACTGGCAGG - Intronic
969177858 4:5412909-5412931 CCTTCTGGGCTGAGACAGGATGG - Intronic
970280417 4:14449016-14449038 CCTTCTGGTCTGAGAGTGGGAGG - Intergenic
974697367 4:65393499-65393521 CCTTCTTAGCTGACTGTGGCTGG + Intronic
978624224 4:110666220-110666242 CCTTCTTGGGTGCCACAGGCAGG - Intergenic
979904646 4:126271488-126271510 CCTTCTTGGCTAATGCTGGCTGG - Intergenic
980807456 4:137831821-137831843 CCTTCCTGGCAGAGTCTGCCAGG + Intergenic
982170250 4:152655238-152655260 CCTTCTTGGCTGAGACTGGCTGG + Intronic
983005105 4:162475142-162475164 ACTTCTTGGCTGAGGTTGGAGGG + Intergenic
983104317 4:163667272-163667294 CATTCTTGGCTGAAACTGCAAGG + Intronic
983734068 4:171035532-171035554 CCTTCTTGGATGGTACTGGCAGG + Intergenic
985590539 5:762213-762235 CCATCTGGGCTGTGAGTGGCTGG - Intronic
986131046 5:4930515-4930537 CCTTCTTTGCTGGGGCTGCCAGG - Intergenic
986653050 5:9983530-9983552 GATGCTTGGCTGAGTCTGGCTGG - Intergenic
987049892 5:14140481-14140503 TCTTGTTTTCTGAGACTGGCTGG + Intergenic
991168571 5:63593401-63593423 CCTGCTTGGCTGGGCGTGGCTGG - Intergenic
991646189 5:68802708-68802730 CCTGTCTGGCTGTGACTGGCAGG - Intergenic
993014737 5:82522460-82522482 TCATATTGGCTAAGACTGGCTGG - Intergenic
993402207 5:87467510-87467532 CCAGCTTGGCTGAGATTGGCTGG - Intergenic
994353373 5:98770302-98770324 CCTTCTTGGGAGCGAGTGGCTGG + Intronic
994770325 5:103973512-103973534 CCAGCTTGGCTGAGATTGGCTGG + Intergenic
998108415 5:139482879-139482901 CCTTCTGGGCAGAAACCGGCAGG - Intronic
998173608 5:139886694-139886716 CCATCTTGGCTGGGTCAGGCAGG - Intronic
998184640 5:139968858-139968880 CCTCCTGGGCTGAGGCTGGGAGG - Intronic
999448722 5:151662754-151662776 CCTTCCTGGCTGAAACAGCCTGG + Exonic
1000816283 5:165926660-165926682 GCTTCATGGCAGAAACTGGCTGG + Intergenic
1001454315 5:171848890-171848912 CCTGCCTGGCAGAGACCGGCTGG - Intergenic
1002146609 5:177188018-177188040 TCTTCCAGGCTTAGACTGGCAGG - Intronic
1002174026 5:177391327-177391349 CCTTCTTGCCTGGGACTGTGTGG - Intronic
1008351193 6:50492334-50492356 CCTCCTTGGCTTAGCCAGGCTGG + Intergenic
1008645001 6:53504839-53504861 TCCTCTTGGCAGAGAGTGGCTGG - Intronic
1009545705 6:65017551-65017573 CCAGCTTAGCTGATACTGGCGGG - Intronic
1013819174 6:114134729-114134751 CCTTCTATGCTGGGACTGCCAGG + Intronic
1017564236 6:155667069-155667091 CCTTCTTGGCTGAGAATGACGGG - Intergenic
1019135948 6:169907815-169907837 CCTCCTTGACTGAGAGTGGAGGG + Intergenic
1019729775 7:2623493-2623515 CCTCCAGAGCTGAGACTGGCAGG + Intergenic
1023026657 7:36056740-36056762 CTTTCATGGCTGCCACTGGCAGG + Intergenic
1024453790 7:49579995-49580017 TCTCCTTGCCTGAGGCTGGCCGG - Intergenic
1029652573 7:101903438-101903460 CCTACAAGGCTGAGCCTGGCAGG + Intronic
1031754392 7:125619242-125619264 CCTGCTTGGGTGGGATTGGCTGG - Intergenic
1032195371 7:129785627-129785649 CTTTCTTGGATGAGAATGCCCGG + Intergenic
1033308986 7:140245878-140245900 GATTCTTTGCTAAGACTGGCTGG - Intergenic
1035218722 7:157391512-157391534 CCTGCTTGGCAGGGACTGGCAGG - Intronic
1035839319 8:2793683-2793705 CGTCCTTGACAGAGACTGGCTGG - Intergenic
1035887021 8:3302368-3302390 CCTTCTTGGCTGAGTTTCCCTGG + Intronic
1036815910 8:11902707-11902729 CCTTCCTGTCTGTGACTGGAGGG + Intergenic
1038925849 8:32138530-32138552 GCTCCTAGGCTGTGACTGGCAGG + Intronic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1045699223 8:104847508-104847530 GCTTCTGGGCTGAGACTATCAGG + Intronic
1047682527 8:127268833-127268855 CCTGCTTGGTTGAGAATGCCAGG - Intergenic
1048528557 8:135226886-135226908 CCTTCTTGGATGAGAATCCCAGG + Intergenic
1051498804 9:17754877-17754899 TCTTTTTGGCTGAGACTGTGGGG + Intronic
1051618912 9:19032565-19032587 CCTCCTTGGCTGACACTTTCTGG + Intronic
1055349971 9:75376544-75376566 CTTTCTTGGAAGAGTCTGGCTGG + Intergenic
1057217836 9:93239182-93239204 CCTTCGAGGCTGGGTCTGGCTGG + Intronic
1186845224 X:13524043-13524065 CCTTCATGGCAGAGTCTGACAGG + Intergenic
1188757880 X:33987094-33987116 CATTGGTGGCTGAGACAGGCTGG + Intergenic
1188771417 X:34158415-34158437 CCCTCTGGGCTCACACTGGCTGG + Intergenic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1190974797 X:55388912-55388934 TCTGCTTGACTGAGATTGGCTGG + Intergenic
1191117150 X:56864328-56864350 CCTTCTTGACTAAGACTTACGGG - Intergenic
1194872194 X:99146384-99146406 CCTGCTTGGCTGGAATTGGCTGG + Intergenic
1196574710 X:117304654-117304676 CCTGCTCAGCTGAGATTGGCTGG + Intergenic
1197136614 X:123067981-123068003 CCTTTTGGGCTGAGACTGTGGGG - Intergenic
1197566525 X:128094663-128094685 CCATCTTGGCTGATACTGGCTGG - Intergenic
1198428808 X:136545859-136545881 CCTTTTTCGGTGAAACTGGCAGG - Intronic
1198725138 X:139668568-139668590 CCTGCTTGGCCGGGATTGGCAGG - Intronic
1201390353 Y:13490566-13490588 CCTGCTTGGCTGGGATTGGCTGG - Intergenic
1201522885 Y:14896176-14896198 CCTTCTTGGCTGCAGTTGGCAGG + Intergenic