ID: 982173460

View in Genome Browser
Species Human (GRCh38)
Location 4:152683404-152683426
Sequence CTGGATGTACAAATGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982173460_982173463 -1 Left 982173460 4:152683404-152683426 CCACTGTCCATTTGTACATCCAG No data
Right 982173463 4:152683426-152683448 GTCTCCCAACACACACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982173460 Original CRISPR CTGGATGTACAAATGGACAG TGG (reversed) Intergenic
No off target data available for this crispr