ID: 982173460 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:152683404-152683426 |
| Sequence | CTGGATGTACAAATGGACAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 982173460_982173463 | -1 | Left | 982173460 | 4:152683404-152683426 | CCACTGTCCATTTGTACATCCAG | No data | ||
| Right | 982173463 | 4:152683426-152683448 | GTCTCCCAACACACACCCACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 982173460 | Original CRISPR | CTGGATGTACAAATGGACAG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||