ID: 982174048

View in Genome Browser
Species Human (GRCh38)
Location 4:152688740-152688762
Sequence CAGGGCACGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982174034_982174048 29 Left 982174034 4:152688688-152688710 CCAGGAATTAAGAGTGCACCTCT 0: 1
1: 0
2: 0
3: 9
4: 131
Right 982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG No data
982174037_982174048 11 Left 982174037 4:152688706-152688728 CCTCTGGAGAAGGAGATTGAAAG 0: 1
1: 0
2: 0
3: 23
4: 253
Right 982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982174048 Original CRISPR CAGGGCACGGAGGAGGAGGA GGG Intronic
No off target data available for this crispr